Incidental Mutation 'PIT4812001:Rbm19'
List |< first << previous [record 48 of 62] next >> last >|
ID556903
Institutional Source Beutler Lab
Gene Symbol Rbm19
Ensembl Gene ENSMUSG00000029594
Gene NameRNA binding motif protein 19
Synonyms1200009A02Rik
Accession Numbers

Genbank: NM_028762 ; MGI: 1921361

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location120116465-120198981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120128250 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 446 (V446A)
Ref Sequence ENSEMBL: ENSMUSP00000031590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031590] [ENSMUST00000202777]
PDB Structure Solution structure of the N-terminal RNA binding domain from hypothetical protein BAB23448 [SOLUTION NMR]
Solution structure of the second RNA binding domain from hypothetical protein BAB23448 [SOLUTION NMR]
Solution structure of the penultimate RNA recognition motif of hypothetical RNA-binding protein RBM19 [SOLUTION NMR]
Solution structure of the C-terminal RNA recognition motif of hypothetical RNA-binding protein RBM19 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031590
AA Change: V446A

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031590
Gene: ENSMUSG00000029594
AA Change: V446A

DomainStartEndE-ValueType
RRM 3 75 7.64e-20 SMART
Pfam:RRM_u2 81 277 1.7e-10 PFAM
RRM 294 364 9.14e-9 SMART
RRM 401 474 6.4e-22 SMART
RRM 585 652 1.6e-4 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 4.59e-23 SMART
RRM 825 900 9.4e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202777
AA Change: V446A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144339
Gene: ENSMUSG00000029594
AA Change: V446A

DomainStartEndE-ValueType
RRM 3 75 3.3e-22 SMART
Pfam:RRM_u2 81 269 1.2e-6 PFAM
RRM 294 364 3.9e-11 SMART
RRM 401 474 2.7e-24 SMART
RRM 585 652 7e-7 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 2e-25 SMART
Pfam:RRM_6 826 865 1.1e-3 PFAM
Pfam:RRM_1 826 870 8.5e-6 PFAM
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that contains six RNA-binding motifs. The encoded protein may be involved in regulating ribosome biogenesis. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit failure to undergo compaction, growth arrest at the morula stage, and apoptosis such that no embryos are observed at E6.5. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Rbm19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rbm19 APN 5 120143438 splice site probably benign
IGL01750:Rbm19 APN 5 120118792 missense probably benign 0.00
IGL01830:Rbm19 APN 5 120124695 missense possibly damaging 0.95
IGL02028:Rbm19 APN 5 120120236 missense probably damaging 1.00
IGL02262:Rbm19 APN 5 120143405 missense probably damaging 0.99
IGL03030:Rbm19 APN 5 120131246 missense probably damaging 1.00
IGL03094:Rbm19 APN 5 120122958 missense probably damaging 1.00
N/A:Rbm19 UTSW 5 120144097 missense probably damaging 0.99
R0190:Rbm19 UTSW 5 120144046 missense probably benign 0.30
R0350:Rbm19 UTSW 5 120128307 missense possibly damaging 0.75
R0594:Rbm19 UTSW 5 120128316 critical splice donor site probably null
R0924:Rbm19 UTSW 5 120126204 missense probably benign 0.11
R0930:Rbm19 UTSW 5 120126204 missense probably benign 0.11
R0963:Rbm19 UTSW 5 120130734 missense possibly damaging 0.83
R1144:Rbm19 UTSW 5 120123016 missense possibly damaging 0.87
R1438:Rbm19 UTSW 5 120122896 missense probably benign 0.01
R1441:Rbm19 UTSW 5 120131176 missense probably damaging 1.00
R1458:Rbm19 UTSW 5 120144029 missense probably benign 0.00
R1518:Rbm19 UTSW 5 120140280 small deletion probably benign
R1992:Rbm19 UTSW 5 120133883 critical splice donor site probably null
R2029:Rbm19 UTSW 5 120120242 missense possibly damaging 0.85
R3055:Rbm19 UTSW 5 120133010 missense probably damaging 1.00
R4356:Rbm19 UTSW 5 120140362 missense possibly damaging 0.72
R4808:Rbm19 UTSW 5 120118774 missense probably damaging 0.99
R4817:Rbm19 UTSW 5 120133734 intron probably benign
R4857:Rbm19 UTSW 5 120132833 splice site probably benign
R4963:Rbm19 UTSW 5 120141566 missense probably damaging 1.00
R5812:Rbm19 UTSW 5 120141577 missense probably damaging 1.00
R5857:Rbm19 UTSW 5 120132942 missense probably damaging 1.00
R5878:Rbm19 UTSW 5 120132867 missense probably damaging 1.00
R5976:Rbm19 UTSW 5 120140307 missense probably benign 0.01
R6345:Rbm19 UTSW 5 120127040 missense possibly damaging 0.87
R6489:Rbm19 UTSW 5 120120130 missense probably benign 0.06
R6495:Rbm19 UTSW 5 120119680 missense probably damaging 1.00
R7081:Rbm19 UTSW 5 120123151 critical splice donor site probably null
R7181:Rbm19 UTSW 5 120116467 unclassified probably benign
R7307:Rbm19 UTSW 5 120186218 missense possibly damaging 0.55
R8058:Rbm19 UTSW 5 120140375 critical splice donor site probably null
R8432:Rbm19 UTSW 5 120175926 missense probably damaging 1.00
R8696:Rbm19 UTSW 5 120127067 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCACAGATGCCTTTAGCCC -3'
(R):5'- CAAGGTTAGAGATCCCACCCTC -3'

Sequencing Primer
(F):5'- AAGCTGGTTGGCTCTCAC -3'
(R):5'- CTCTAAAAGCTTTCATCACGTGACAG -3'
Posted On2019-06-07