Incidental Mutation 'PIT4812001:Dctn1'
ID556907
Institutional Source Beutler Lab
Gene Symbol Dctn1
Ensembl Gene ENSMUSG00000031865
Gene Namedynactin 1
Synonymsp150, Glued, p150
Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4812001 (G1)
Quality Score199.009
Status Not validated
Chromosome6
Chromosomal Location83165920-83200117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83199762 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1266 (V1266E)
Ref Sequence ENSEMBL: ENSMUSP00000109552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077407
AA Change: V1224E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865
AA Change: V1224E

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113907
AA Change: V1127E

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865
AA Change: V1127E

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
low complexity region 27 50 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
SCOP:d1lxa__ 271 345 8e-3 SMART
Pfam:Dynactin 392 671 7.1e-91 PFAM
low complexity region 703 723 N/A INTRINSIC
coiled coil region 817 912 N/A INTRINSIC
low complexity region 928 946 N/A INTRINSIC
coiled coil region 1046 1075 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113913
AA Change: V1249E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865
AA Change: V1249E

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113918
AA Change: V1228E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865
AA Change: V1228E

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 526 805 3.3e-90 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
coiled coil region 1147 1176 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113919
AA Change: V1266E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865
AA Change: V1266E

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
SCOP:d1fxkc_ 222 374 3e-3 SMART
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 522 805 1.4e-103 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
low complexity region 1068 1086 N/A INTRINSIC
coiled coil region 1185 1214 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Dctn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Dctn1 APN 6 83179897 missense probably benign 0.00
IGL01450:Dctn1 APN 6 83194110 unclassified probably benign
IGL01876:Dctn1 APN 6 83197921 missense probably damaging 1.00
IGL01958:Dctn1 APN 6 83191344 missense possibly damaging 0.95
IGL02554:Dctn1 APN 6 83182722 missense probably damaging 1.00
IGL02668:Dctn1 APN 6 83191048 missense possibly damaging 0.89
IGL02814:Dctn1 APN 6 83189914 missense probably damaging 1.00
IGL02818:Dctn1 APN 6 83192514 missense possibly damaging 0.86
IGL03007:Dctn1 APN 6 83182708 missense probably damaging 1.00
IGL03065:Dctn1 APN 6 83192493 missense probably damaging 0.99
IGL03083:Dctn1 APN 6 83197484 splice site probably benign
IGL03394:Dctn1 APN 6 83191284 missense possibly damaging 0.61
E0374:Dctn1 UTSW 6 83194174 missense possibly damaging 0.93
IGL03014:Dctn1 UTSW 6 83197369 intron probably benign
R0044:Dctn1 UTSW 6 83191134 missense probably damaging 1.00
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0057:Dctn1 UTSW 6 83179892 missense probably benign 0.14
R0731:Dctn1 UTSW 6 83183089 missense probably damaging 0.98
R0738:Dctn1 UTSW 6 83190107 critical splice donor site probably null
R0755:Dctn1 UTSW 6 83189077 missense probably damaging 0.96
R0839:Dctn1 UTSW 6 83190477 missense possibly damaging 0.53
R1035:Dctn1 UTSW 6 83190220 missense probably damaging 1.00
R1454:Dctn1 UTSW 6 83197508 missense possibly damaging 0.93
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1627:Dctn1 UTSW 6 83195082 missense probably damaging 0.99
R1631:Dctn1 UTSW 6 83197596 missense possibly damaging 0.56
R1812:Dctn1 UTSW 6 83192518 missense possibly damaging 0.85
R1928:Dctn1 UTSW 6 83199184 splice site probably benign
R2008:Dctn1 UTSW 6 83189956 missense probably damaging 0.99
R2242:Dctn1 UTSW 6 83199705 missense probably damaging 0.99
R2259:Dctn1 UTSW 6 83197586 missense possibly damaging 0.46
R2422:Dctn1 UTSW 6 83199800 missense possibly damaging 0.92
R2483:Dctn1 UTSW 6 83194187 missense probably damaging 1.00
R4455:Dctn1 UTSW 6 83195049 missense probably damaging 1.00
R4724:Dctn1 UTSW 6 83189938 missense possibly damaging 0.53
R4812:Dctn1 UTSW 6 83189937 missense probably benign 0.24
R4819:Dctn1 UTSW 6 83190519 missense probably damaging 0.97
R4831:Dctn1 UTSW 6 83199771 missense possibly damaging 0.46
R4928:Dctn1 UTSW 6 83189207 missense possibly damaging 0.73
R5087:Dctn1 UTSW 6 83191639 missense probably damaging 1.00
R5354:Dctn1 UTSW 6 83183126 missense possibly damaging 0.93
R5372:Dctn1 UTSW 6 83190210 missense probably damaging 0.96
R5493:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5494:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5732:Dctn1 UTSW 6 83197949 critical splice donor site probably null
R5856:Dctn1 UTSW 6 83197865 missense probably damaging 1.00
R6025:Dctn1 UTSW 6 83193691 intron probably null
R6999:Dctn1 UTSW 6 83191281 missense possibly damaging 0.89
R7052:Dctn1 UTSW 6 83195280 intron probably null
R7133:Dctn1 UTSW 6 83180044 intron probably null
R7485:Dctn1 UTSW 6 83189905 missense possibly damaging 0.85
R7607:Dctn1 UTSW 6 83195069 nonsense probably null
R7729:Dctn1 UTSW 6 83183060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTACCGTGGTGTCAGACG -3'
(R):5'- AACCCAGGTTACGGAAGCAG -3'

Sequencing Primer
(F):5'- AGACGTGAAGCCTCAGTTTC -3'
(R):5'- TTACGGAAGCAGCAGGACCC -3'
Posted On2019-06-07