Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4812001:Cracr2a'

556910

Institutional Source

Beutler Lab

Gene Symbol

Cracr2a

Ensembl Gene

ENSMUSG00000061414

Gene Name

calcium release activated channel regulator 2A

Synonyms

LOC243645, Efcab4b, LOC381812

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4812001 (G1)

Quality Score

198.009

Status

Not validated

Chromosome

Chromosomal Location

127561338-127674248 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 127625870 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 230 (L230P)

Ref Sequence

ENSEMBL: ENSMUSP00000071494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071563] [ENSMUST00000212051]

AlphaFold

Q3UP38

Predicted Effect

probably damaging
Transcript: ENSMUST00000071563
AA Change: L230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071494
Gene: ENSMUSG00000061414
AA Change: L230P

Domain	Start	End	E-Value	Type
EFh	48	76	2.82e1	SMART
EFh	82	110	2.09e-4	SMART
coiled coil region	192	282	N/A	INTRINSIC
low complexity region	295	307	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212051
AA Change: L230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 93.8%
3x: 91.0%
10x: 85.3%
20x: 73.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	T	C	18: 6,630,053	S252P	possibly damaging	Het
4933409G03Rik	G	A	2: 68,588,948	V14I	probably benign	Het
Adgrf5	T	G	17: 43,450,369	V985G	probably damaging	Het
Ankrd44	A	T	1: 54,723,038	Y542*	probably null	Het
Atp13a3	T	C	16: 30,362,578	T75A	probably damaging	Het
Atr	T	C	9: 95,910,649	F1675L	probably benign	Het
Atrnl1	A	G	19: 57,731,623	I1082V	probably benign	Het
C87977	A	G	4: 144,209,516	I56T	probably benign	Het
Clip1	T	A	5: 123,630,675	R620S	probably benign	Het
Cped1	T	C	6: 22,122,294	F391S	probably benign	Het
Dctn1	T	A	6: 83,199,762	V1266E	possibly damaging	Het
Dlg1	T	A	16: 31,846,885	F687I	probably benign	Het
Dnah8	C	A	17: 30,708,445	D1358E	probably benign	Het
Dnajc11	A	G	4: 151,952,889	R84G	probably benign	Het
Dnajc14	C	A	10: 128,806,683	T158N	probably damaging	Het
Dscc1	A	G	15: 55,082,261	L346P	probably damaging	Het
Efcab3	A	G	11: 105,099,979	I71V	probably null	Het
Erbb3	T	A	10: 128,574,379	Q670L	possibly damaging	Het
Ercc4	G	A	16: 13,144,447	E652K	probably benign	Het
Ercc6l2	T	A	13: 63,858,257	V591D	possibly damaging	Het
Fam126b	T	G	1: 58,548,703	D117A	possibly damaging	Het
Fam3c	C	T	6: 22,321,370	G134E	probably damaging	Het
Frmd5	A	G	2: 121,586,446	V70A	probably benign	Het
Gjc1	A	T	11: 102,800,981	Y65*	probably null	Het
Gm3033	A	C	14: 3,848,891	L137F		Het
Gria4	C	A	9: 4,427,128	A771S	probably damaging	Het
Hc	A	G	2: 35,029,452	L674P	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Inpp5f	A	T	7: 128,692,308	Y696F	probably benign	Het
Itga11	C	A	9: 62,732,193	Q157K	probably damaging	Het
Itgb5	G	T	16: 33,919,987	C489F	probably damaging	Het
Klhl38	C	T	15: 58,322,542	G264S	probably benign	Het
Krt78	C	T	15: 101,948,069	V436M	probably damaging	Het
Mia2	A	T	12: 59,101,579	D75V	possibly damaging	Het
Mphosph6	T	A	8: 117,799,149	Q20L	probably damaging	Het
Ogfr	C	T	2: 180,595,511	P630S	possibly damaging	Het
Olfr1206	G	A	2: 88,864,970	V122M	probably benign	Het
Olfr1431	T	G	19: 12,210,253	I229S	probably damaging	Het
Olfr15	A	T	16: 3,839,530	K186*	probably null	Het
Pbx3	T	C	2: 34,224,619	E101G	probably damaging	Het
Pcca	T	A	14: 122,790,382	N587K	probably benign	Het
Pdia3	G	T	2: 121,433,530	A287S	probably damaging	Het
Pfas	T	A	11: 68,990,036	D209V		Het
Pter	A	T	2: 12,980,368	I170F	probably damaging	Het
Ptprq	A	T	10: 107,666,567	V830E	probably damaging	Het
Rab11fip5	T	C	6: 85,341,558	D783G	probably benign	Het
Rbm19	T	C	5: 120,128,250	V446A	possibly damaging	Het
Selp	A	G	1: 164,132,263	N363D	probably benign	Het
Six2	C	A	17: 85,685,301	S258I	possibly damaging	Het
Smc1b	A	G	15: 85,069,651	V1139A	possibly damaging	Het
Sp1	A	G	15: 102,408,408	T121A	possibly damaging	Het
Sucla2	A	T	14: 73,579,449	I210L	possibly damaging	Het
Trank1	T	C	9: 111,347,912	L339P	probably damaging	Het
Ttll5	T	A	12: 85,926,861	D794E	probably benign	Het
Usp32	C	T	11: 85,010,074	V1107I	probably damaging	Het
Vmn1r195	T	C	13: 22,278,863	Y168H	probably benign	Het
Vmn1r223	A	G	13: 23,249,890	N218S	probably damaging	Het
Vmn2r25	T	A	6: 123,823,488	S632C	probably damaging	Het
Vwa3a	A	T	7: 120,776,133	K390I	probably damaging	Het
Zfp442	A	T	2: 150,409,741	C80*	probably null	Het
Zic1	A	T	9: 91,364,341	I226N	probably damaging	Het

Other mutations in Cracr2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02136:Cracr2a	APN	6	127629930	intron	probably benign
R0111:Cracr2a	UTSW	6	127604061	missense	probably benign	0.00
R0180:Cracr2a	UTSW	6	127604074	critical splice donor site	probably null
R1612:Cracr2a	UTSW	6	127603929	nonsense	probably null
R1929:Cracr2a	UTSW	6	127607298	missense	probably damaging	1.00
R2055:Cracr2a	UTSW	6	127608601	nonsense	probably null
R2270:Cracr2a	UTSW	6	127607298	missense	probably damaging	1.00
R2272:Cracr2a	UTSW	6	127607298	missense	probably damaging	1.00
R2915:Cracr2a	UTSW	6	127611505	missense	probably damaging	0.98
R4476:Cracr2a	UTSW	6	127629819	missense	probably benign	0.18
R4600:Cracr2a	UTSW	6	127603888	missense	probably benign	0.00
R4767:Cracr2a	UTSW	6	127611507	missense	probably damaging	0.98
R5256:Cracr2a	UTSW	6	127604029	missense	probably damaging	1.00
R5657:Cracr2a	UTSW	6	127604007	missense	probably damaging	1.00
R5729:Cracr2a	UTSW	6	127607236	missense	possibly damaging	0.88
R6437:Cracr2a	UTSW	6	127631831	missense	probably damaging	0.96
R6572:Cracr2a	UTSW	6	127608752	splice site	probably null
R6851:Cracr2a	UTSW	6	127608716	missense	probably damaging	1.00
R7177:Cracr2a	UTSW	6	127608706	missense	probably benign	0.00
R7616:Cracr2a	UTSW	6	127608697	nonsense	probably null
R7809:Cracr2a	UTSW	6	127649962	missense	probably benign
R8030:Cracr2a	UTSW	6	127611423	missense	probably damaging	0.96
R8084:Cracr2a	UTSW	6	127639172	missense	probably benign	0.26
R8731:Cracr2a	UTSW	6	127625927	critical splice donor site	probably null
R8867:Cracr2a	UTSW	6	127629773	nonsense	probably null
Z1177:Cracr2a	UTSW	6	127607244	missense	probably benign	0.02
Z1177:Cracr2a	UTSW	6	127669063	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTGAAGGACTGAGCCTTG -3'
(R):5'- CCAGACATGCTCAGGTAACC -3'

Sequencing Primer
(F):5'- TTGGCTGGCCTGACTTACACAG -3'
(R):5'- ACATGCTCAGGTAACCGAGGC -3'

Posted On

2019-06-07