Incidental Mutation 'PIT4812001:Zic1'
ID556916
Institutional Source Beutler Lab
Gene Symbol Zic1
Ensembl Gene ENSMUSG00000032368
Gene Namezinc finger protein of the cerebellum 1
Synonymsodd-paired homolog
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location91358058-91365810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91364341 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 226 (I226N)
Ref Sequence ENSEMBL: ENSMUSP00000034927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034927] [ENSMUST00000065360] [ENSMUST00000172646] [ENSMUST00000173054] [ENSMUST00000173342]
Predicted Effect probably damaging
Transcript: ENSMUST00000034927
AA Change: I226N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034927
Gene: ENSMUSG00000032368
AA Change: I226N

DomainStartEndE-ValueType
low complexity region 68 85 N/A INTRINSIC
low complexity region 110 134 N/A INTRINSIC
ZnF_C2H2 238 260 6.82e1 SMART
ZnF_C2H2 269 296 7.49e0 SMART
ZnF_C2H2 302 326 8.02e-5 SMART
ZnF_C2H2 332 356 1.58e-3 SMART
ZnF_C2H2 362 384 4.54e-4 SMART
low complexity region 386 400 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065360
AA Change: I226N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068858
Gene: ENSMUSG00000032368
AA Change: I226N

DomainStartEndE-ValueType
low complexity region 68 85 N/A INTRINSIC
low complexity region 110 134 N/A INTRINSIC
ZnF_C2H2 238 260 6.82e1 SMART
ZnF_C2H2 269 296 7.49e0 SMART
ZnF_C2H2 302 326 8.02e-5 SMART
ZnF_C2H2 332 356 1.58e-3 SMART
ZnF_C2H2 362 384 4.54e-4 SMART
low complexity region 386 400 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172646
SMART Domains Protein: ENSMUSP00000134053
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 128 162 4.74e1 SMART
ZnF_C2H2 171 198 7.68e0 SMART
ZnF_C2H2 204 228 8.02e-5 SMART
ZnF_C2H2 234 258 7.15e-2 SMART
ZnF_C2H2 264 288 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173054
SMART Domains Protein: ENSMUSP00000134364
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
PDB:2EJ4|A 122 181 3e-16 PDB
Blast:ZnF_C2H2 128 151 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173342
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development. Aberrant expression of this gene is seen in medulloblastoma, a childhood brain tumor. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 4, a related family member on chromosome 3. This gene encodes a transcription factor that can bind and transactivate the apolipoprotein E gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show cerebellar hypoplasia with a missing lobule of the anterior lobe. Newborn pups suckle poorly. 50% die within one day of birth and almost all die within 3 weeks; longer survivors show marked ataxia and exhibit tonic convulsions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Other mutations in Zic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02022:Zic1 APN 9 91362472 splice site probably null
IGL02669:Zic1 APN 9 91364433 missense possibly damaging 0.71
IGL02968:Zic1 APN 9 91362490 missense probably damaging 1.00
R1493:Zic1 UTSW 9 91364756 missense probably damaging 1.00
R1599:Zic1 UTSW 9 91361688 missense probably benign 0.08
R1742:Zic1 UTSW 9 91361576 missense probably damaging 0.98
R2158:Zic1 UTSW 9 91364893 missense possibly damaging 0.73
R4587:Zic1 UTSW 9 91364822 missense probably damaging 1.00
R4735:Zic1 UTSW 9 91364505 missense possibly damaging 0.55
R4830:Zic1 UTSW 9 91362531 missense probably damaging 1.00
R5186:Zic1 UTSW 9 91364371 missense probably damaging 1.00
R5702:Zic1 UTSW 9 91364080 missense probably damaging 0.99
R6298:Zic1 UTSW 9 91364503 missense probably damaging 1.00
R7221:Zic1 UTSW 9 91364732 missense probably damaging 1.00
R7250:Zic1 UTSW 9 91364975 missense probably damaging 0.99
R7764:Zic1 UTSW 9 91365692 intron probably benign
R7806:Zic1 UTSW 9 91364971 missense probably damaging 1.00
R7951:Zic1 UTSW 9 91362601 missense probably damaging 0.99
R8408:Zic1 UTSW 9 91364794 missense probably damaging 0.97
R8483:Zic1 UTSW 9 91364371 missense probably damaging 1.00
RF011:Zic1 UTSW 9 91364330 missense probably benign 0.00
Z1177:Zic1 UTSW 9 91364579 missense probably damaging 1.00
Z1186:Zic1 UTSW 9 91361730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAACGCGCGAAAACCTTG -3'
(R):5'- GTTTCTCCGGGGACATGTAC -3'

Sequencing Primer
(F):5'- CACTCGGATGTGGTTGACC -3'
(R):5'- ATGTACCCACGGCCGGAAC -3'
Posted On2019-06-07