Incidental Mutation 'PIT4812001:Gjc1'
ID556924
Institutional Source Beutler Lab
Gene Symbol Gjc1
Ensembl Gene ENSMUSG00000034520
Gene Namegap junction protein, gamma 1
Synonymsconnexin 45, Cx45, Gja7, Gja-7
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102799579-102819700 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 102800981 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 65 (Y65*)
Ref Sequence ENSEMBL: ENSMUSP00000066901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068933] [ENSMUST00000092567] [ENSMUST00000107075]
Predicted Effect probably null
Transcript: ENSMUST00000068933
AA Change: Y65*
SMART Domains Protein: ENSMUSP00000066901
Gene: ENSMUSG00000034520
AA Change: Y65*

DomainStartEndE-ValueType
CNX 42 75 1.57e-17 SMART
low complexity region 128 137 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
Connexin_CCC 187 253 3.44e-41 SMART
coiled coil region 333 358 N/A INTRINSIC
low complexity region 368 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092567
AA Change: Y65*
SMART Domains Protein: ENSMUSP00000090228
Gene: ENSMUSG00000034520
AA Change: Y65*

DomainStartEndE-ValueType
CNX 42 75 1.57e-17 SMART
low complexity region 128 137 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
Connexin_CCC 187 253 3.44e-41 SMART
coiled coil region 333 358 N/A INTRINSIC
low complexity region 368 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107075
AA Change: Y65*
SMART Domains Protein: ENSMUSP00000102690
Gene: ENSMUSG00000034520
AA Change: Y65*

DomainStartEndE-ValueType
CNX 42 75 1.57e-17 SMART
low complexity region 128 137 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
Connexin_CCC 187 253 3.44e-41 SMART
coiled coil region 333 358 N/A INTRINSIC
low complexity region 368 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Alternatively spliced transcript variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired vascular and cardiac development resulting in retarded growth and lethality between embryonic day 9.5 -10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Gjc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Gjc1 APN 11 102800726 missense probably benign 0.16
IGL03164:Gjc1 APN 11 102800721 missense possibly damaging 0.81
IGL03396:Gjc1 APN 11 102800527 missense probably benign 0.00
R0683:Gjc1 UTSW 11 102800411 missense probably benign 0.00
R1712:Gjc1 UTSW 11 102800880 missense possibly damaging 0.96
R3853:Gjc1 UTSW 11 102800126 missense probably benign 0.10
R4948:Gjc1 UTSW 11 102800421 missense probably damaging 1.00
R5564:Gjc1 UTSW 11 102800203 missense probably benign 0.04
R6577:Gjc1 UTSW 11 102800304 missense possibly damaging 0.69
R6939:Gjc1 UTSW 11 102800907 missense probably damaging 0.98
R7263:Gjc1 UTSW 11 102800137 missense possibly damaging 0.69
R7352:Gjc1 UTSW 11 102800452 missense probably damaging 1.00
R7900:Gjc1 UTSW 11 102800094 missense probably benign 0.00
R8187:Gjc1 UTSW 11 102800555 nonsense probably null
Z1176:Gjc1 UTSW 11 102800008 missense unknown
Predicted Primers PCR Primer
(F):5'- AACGCATGGCATAGGGTTTG -3'
(R):5'- GGTACTTTTCACCTACCAGGGC -3'

Sequencing Primer
(F):5'- CATAGGGTTTGCTCCGAGC -3'
(R):5'- CATGAGTTGGAGCTTCCTGACTC -3'
Posted On2019-06-07