Incidental Mutation 'PIT4812001:Ttll5'
List |< first << previous [record 55 of 62] next >> last >|
ID556927
Institutional Source Beutler Lab
Gene Symbol Ttll5
Ensembl Gene ENSMUSG00000012609
Gene Nametubulin tyrosine ligase-like family, member 5
SynonymsSTAMP
Accession Numbers

Genbank: NM_001081423

Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location85824659-86061893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85926861 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 794 (D794E)
Ref Sequence ENSEMBL: ENSMUSP00000048809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]
Predicted Effect probably benign
Transcript: ENSMUST00000040179
AA Change: D794E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: D794E

DomainStartEndE-ValueType
Pfam:TTL 110 407 1.9e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040273
AA Change: D794E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: D794E

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110224
AA Change: D781E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: D781E

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 543 562 N/A INTRINSIC
low complexity region 582 608 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 768 780 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155448
SMART Domains Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 6.4e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176460
AA Change: D260E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000176695
SMART Domains Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176937
AA Change: D92E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000177114
SMART Domains Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177168
AA Change: D229E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134874
Gene: ENSMUSG00000012609
AA Change: D229E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 603 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Ttll5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Ttll5 APN 12 85843826 missense probably damaging 1.00
IGL00932:Ttll5 APN 12 85929907 missense probably damaging 1.00
IGL00964:Ttll5 APN 12 85849283 missense possibly damaging 0.78
IGL00978:Ttll5 APN 12 85933482 nonsense probably null
IGL00990:Ttll5 APN 12 85876589 missense probably damaging 1.00
IGL01726:Ttll5 APN 12 85918934 missense probably benign 0.30
IGL01797:Ttll5 APN 12 85956597 missense possibly damaging 0.54
IGL02008:Ttll5 APN 12 85933611 missense probably damaging 1.00
IGL02210:Ttll5 APN 12 85912545 intron probably benign
IGL02979:Ttll5 APN 12 85826582 missense probably damaging 1.00
IGL03079:Ttll5 APN 12 85876558 missense probably damaging 1.00
IGL03149:Ttll5 APN 12 85918984 missense probably damaging 0.98
G4846:Ttll5 UTSW 12 86024244 missense probably damaging 0.99
R0045:Ttll5 UTSW 12 85879359 splice site probably benign
R0153:Ttll5 UTSW 12 85831966 missense probably damaging 1.00
R0282:Ttll5 UTSW 12 85996053 missense probably benign 0.12
R0318:Ttll5 UTSW 12 85876594 critical splice donor site probably null
R0465:Ttll5 UTSW 12 85933326 missense probably benign 0.42
R0540:Ttll5 UTSW 12 85933676 critical splice donor site probably null
R1086:Ttll5 UTSW 12 85891079 missense possibly damaging 0.66
R1467:Ttll5 UTSW 12 85918962 splice site probably null
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1505:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R1524:Ttll5 UTSW 12 85864568 nonsense probably null
R1540:Ttll5 UTSW 12 85892208 nonsense probably null
R1598:Ttll5 UTSW 12 85863598 missense probably damaging 0.98
R1649:Ttll5 UTSW 12 85923014 missense probably damaging 1.00
R1774:Ttll5 UTSW 12 85933402 missense probably benign 0.09
R2340:Ttll5 UTSW 12 85892148 missense probably benign 0.02
R4049:Ttll5 UTSW 12 86012799 missense probably benign 0.01
R4094:Ttll5 UTSW 12 85956602 nonsense probably null
R4095:Ttll5 UTSW 12 85956602 nonsense probably null
R4908:Ttll5 UTSW 12 85919174 missense probably benign 0.31
R5012:Ttll5 UTSW 12 85926844 missense possibly damaging 0.93
R5137:Ttll5 UTSW 12 85923045 missense possibly damaging 0.83
R5416:Ttll5 UTSW 12 86012828 missense possibly damaging 0.77
R5773:Ttll5 UTSW 12 85933555 frame shift probably null
R5774:Ttll5 UTSW 12 85933555 frame shift probably null
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6173:Ttll5 UTSW 12 85933377 missense probably damaging 0.99
R6343:Ttll5 UTSW 12 85956699 missense probably benign 0.00
R6449:Ttll5 UTSW 12 86024276 missense probably benign 0.00
R6750:Ttll5 UTSW 12 85956610 missense probably damaging 0.98
R6802:Ttll5 UTSW 12 85879386 missense probably damaging 1.00
R6825:Ttll5 UTSW 12 85883328 splice site probably null
R6955:Ttll5 UTSW 12 85864579 missense possibly damaging 0.91
R7098:Ttll5 UTSW 12 85917673 critical splice acceptor site probably null
R7154:Ttll5 UTSW 12 85925764 missense probably damaging 0.98
R7215:Ttll5 UTSW 12 85933396 missense probably benign 0.02
R7339:Ttll5 UTSW 12 85857464 critical splice donor site probably null
R7520:Ttll5 UTSW 12 85899471 missense probably damaging 1.00
R7728:Ttll5 UTSW 12 85956632 missense probably benign 0.02
R7894:Ttll5 UTSW 12 85889174 missense probably damaging 1.00
R8119:Ttll5 UTSW 12 86020548 missense probably damaging 0.98
R8129:Ttll5 UTSW 12 85891084 critical splice donor site probably null
R8200:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R8357:Ttll5 UTSW 12 85876578 missense probably damaging 1.00
R8413:Ttll5 UTSW 12 85919121 missense probably benign 0.00
R8457:Ttll5 UTSW 12 85876578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACCAAAAGTAGCTTGTC -3'
(R):5'- CACAACTGGCTGAGAAACGG -3'

Sequencing Primer
(F):5'- GTGACCAAAAGTAGCTTGTCAAATG -3'
(R):5'- GGCCAAGCCTGCAAGAC -3'
Posted On2019-06-07