Incidental Mutation 'PIT4812001:Ercc6l2'
ID556930
Institutional Source Beutler Lab
Gene Symbol Ercc6l2
Ensembl Gene ENSMUSG00000021470
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms0610007P08Rik, 1700019D06Rik, 9330134C04Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #PIT4812001 (G1)
Quality Score167.009
Status Not validated
Chromosome13
Chromosomal Location63815240-63900302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63858257 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 591 (V591D)
Ref Sequence ENSEMBL: ENSMUSP00000069488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021925] [ENSMUST00000021926] [ENSMUST00000067821] [ENSMUST00000095724] [ENSMUST00000159957]
Predicted Effect
SMART Domains Protein: ENSMUSP00000021925
Gene: ENSMUSG00000021470
AA Change: V567D

DomainStartEndE-ValueType
DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 2e-13 BLAST
HELICc 512 589 6.96e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021926
SMART Domains Protein: ENSMUSP00000021926
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
DEXDc 28 216 1.74e-12 SMART
Blast:DEXDc 265 310 1e-13 BLAST
Blast:DEXDc 317 450 4e-30 BLAST
SCOP:d1hv8a2 388 466 7e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000067821
AA Change: V591D

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069488
Gene: ENSMUSG00000021470
AA Change: V591D

DomainStartEndE-ValueType
DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 3e-13 BLAST
HELICc 536 619 3.12e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095724
SMART Domains Protein: ENSMUSP00000093392
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
DEXDc 1 183 2.72e-14 SMART
Blast:DEXDc 232 277 3e-13 BLAST
HELICc 388 471 3.12e-23 SMART
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159957
SMART Domains Protein: ENSMUSP00000124912
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
Pfam:SNF2_N 101 195 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snf2 family of helicase-like proteins. The encoded protein may play a role in DNA repair and mitochondrial function. Mutations in this gene have been associated with bone marrow failure syndrome 2. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Ercc6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Ercc6l2 APN 13 63858319 missense probably damaging 0.99
IGL00678:Ercc6l2 APN 13 63844613 missense probably damaging 1.00
IGL00765:Ercc6l2 APN 13 63848772 missense possibly damaging 0.95
IGL01062:Ercc6l2 APN 13 63847454 missense probably null 1.00
IGL01655:Ercc6l2 APN 13 63819752 nonsense probably null
IGL02175:Ercc6l2 APN 13 63869190 utr 3 prime probably benign
IGL02201:Ercc6l2 APN 13 63852969 missense probably benign 0.12
IGL02351:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02358:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02622:Ercc6l2 APN 13 63853623 splice site probably null
R0142:Ercc6l2 UTSW 13 63872506 unclassified probably benign
R0648:Ercc6l2 UTSW 13 63844645 missense probably benign 0.04
R1136:Ercc6l2 UTSW 13 63869120 missense possibly damaging 0.75
R1536:Ercc6l2 UTSW 13 63824871 missense possibly damaging 0.81
R1706:Ercc6l2 UTSW 13 63872458 unclassified probably benign
R2108:Ercc6l2 UTSW 13 63871988 unclassified probably benign
R2111:Ercc6l2 UTSW 13 63834749 missense probably damaging 1.00
R2126:Ercc6l2 UTSW 13 63848771 missense probably damaging 1.00
R2154:Ercc6l2 UTSW 13 63866007 missense probably damaging 1.00
R3551:Ercc6l2 UTSW 13 63844595 missense probably damaging 1.00
R3773:Ercc6l2 UTSW 13 63841450 missense probably damaging 1.00
R3923:Ercc6l2 UTSW 13 63870735 unclassified probably benign
R4233:Ercc6l2 UTSW 13 63872168 unclassified probably benign
R4782:Ercc6l2 UTSW 13 63834738 missense probably damaging 1.00
R4928:Ercc6l2 UTSW 13 63894813 utr 3 prime probably benign
R5163:Ercc6l2 UTSW 13 63899031 utr 3 prime probably benign
R5268:Ercc6l2 UTSW 13 63869111 missense possibly damaging 0.92
R5423:Ercc6l2 UTSW 13 63872258 unclassified probably benign
R6128:Ercc6l2 UTSW 13 63853749 missense probably damaging 0.98
R6164:Ercc6l2 UTSW 13 63872344 unclassified probably benign
R7238:Ercc6l2 UTSW 13 63865984 missense probably damaging 0.98
R7295:Ercc6l2 UTSW 13 63819775 missense probably damaging 0.96
R7708:Ercc6l2 UTSW 13 63841514 nonsense probably null
R8085:Ercc6l2 UTSW 13 63844553 missense probably benign 0.00
R8131:Ercc6l2 UTSW 13 63834747 missense probably damaging 1.00
R8259:Ercc6l2 UTSW 13 63872471 missense
R8372:Ercc6l2 UTSW 13 63853749 missense probably damaging 0.98
RF013:Ercc6l2 UTSW 13 63853017 missense probably benign 0.06
Z1088:Ercc6l2 UTSW 13 63853728 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCAGTGTAGTATTATACTGATTGCAG -3'
(R):5'- TGGCTACTAAGAAGTTTAGGGTC -3'

Sequencing Primer
(F):5'- AATGAGTTATAGCACAGTGGTTTG -3'
(R):5'- AAATTTTCACCAGTACCCACTTTTTC -3'
Posted On2019-06-07