Incidental Mutation 'PIT4812001:Sucla2'
ID556932
Institutional Source Beutler Lab
Gene Symbol Sucla2
Ensembl Gene ENSMUSG00000022110
Gene Namesuccinate-Coenzyme A ligase, ADP-forming, beta subunit
Synonyms4930547K18Rik
Accession Numbers

Genbank: NM_011506; MGI: 1306775

Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location73525319-73596142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73579449 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 210 (I210L)
Ref Sequence ENSEMBL: ENSMUSP00000022706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022706] [ENSMUST00000160507]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022706
AA Change: I210L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022706
Gene: ENSMUSG00000022110
AA Change: I210L

DomainStartEndE-ValueType
Pfam:ATP-grasp_5 44 277 1.6e-11 PFAM
Pfam:ATP-grasp_2 54 262 9.2e-78 PFAM
Pfam:Ligase_CoA 321 441 2.2e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160507
AA Change: I210L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123765
Gene: ENSMUSG00000022110
AA Change: I210L

DomainStartEndE-ValueType
Pfam:ATP-grasp_5 44 277 3e-11 PFAM
Pfam:ATP-grasp_2 54 262 9.5e-77 PFAM
Pfam:Ligase_CoA 321 441 2.2e-29 PFAM
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Succinyl-CoA synthetase (SCS) is a mitochondrial matrix enzyme that acts as a heterodimer, being composed of an invariant alpha subunit and a substrate-specific beta subunit. The protein encoded by this gene is an ATP-specific SCS beta subunit that dimerizes with the SCS alpha subunit to form SCS-A, an essential component of the tricarboxylic acid cycle. SCS-A hydrolyzes ATP to convert succinate to succinyl-CoA. Defects in this gene are a cause of myopathic mitochondrial DNA depletion syndrome. A pseudogene of this gene has been found on chromosome 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit perinatal lethality with reduced size, placenta mineralization, decreased mitochondrial DNA and respiration. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Sucla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Sucla2 APN 14 73590907 missense possibly damaging 0.81
IGL01539:Sucla2 APN 14 73591121 missense probably damaging 0.97
IGL02064:Sucla2 APN 14 73579473 nonsense probably null
IGL02240:Sucla2 APN 14 73590847 missense probably damaging 1.00
IGL02640:Sucla2 APN 14 73581806 missense probably benign 0.45
IGL02965:Sucla2 APN 14 73579431 missense probably benign 0.00
3-1:Sucla2 UTSW 14 73568957 nonsense probably null
R0189:Sucla2 UTSW 14 73592648 missense probably damaging 1.00
R0764:Sucla2 UTSW 14 73560634 unclassified probably benign
R0765:Sucla2 UTSW 14 73560634 unclassified probably benign
R0844:Sucla2 UTSW 14 73560634 unclassified probably benign
R1065:Sucla2 UTSW 14 73560634 unclassified probably benign
R1067:Sucla2 UTSW 14 73560634 unclassified probably benign
R1136:Sucla2 UTSW 14 73560634 unclassified probably benign
R1162:Sucla2 UTSW 14 73560634 unclassified probably benign
R1311:Sucla2 UTSW 14 73560634 unclassified probably benign
R1312:Sucla2 UTSW 14 73560634 unclassified probably benign
R1345:Sucla2 UTSW 14 73560634 unclassified probably benign
R1416:Sucla2 UTSW 14 73560634 unclassified probably benign
R1677:Sucla2 UTSW 14 73592681 missense probably damaging 1.00
R1968:Sucla2 UTSW 14 73593679 missense probably damaging 0.99
R2126:Sucla2 UTSW 14 73592668 missense possibly damaging 0.71
R2484:Sucla2 UTSW 14 73581709 missense probably benign 0.12
R2566:Sucla2 UTSW 14 73552804 intron probably benign
R3706:Sucla2 UTSW 14 73591052 missense probably damaging 1.00
R4725:Sucla2 UTSW 14 73568989 missense possibly damaging 0.94
R5620:Sucla2 UTSW 14 73595396 missense probably damaging 0.99
R5650:Sucla2 UTSW 14 73591129 missense probably benign 0.38
R5947:Sucla2 UTSW 14 73592669 missense probably damaging 1.00
R6045:Sucla2 UTSW 14 73568964 nonsense probably null
R6236:Sucla2 UTSW 14 73593750 missense probably benign 0.39
R6693:Sucla2 UTSW 14 73568667 nonsense probably null
R7706:Sucla2 UTSW 14 73568993 missense probably damaging 1.00
R8786:Sucla2 UTSW 14 73560465 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGATATGCCCAAATCTGACAC -3'
(R):5'- GCATTCCTGTGCTTTAAAGAAACAC -3'

Sequencing Primer
(F):5'- GATATGCCCAAATCTGACACTGCAC -3'
(R):5'- CTGTGCTTTAAAGAAACACAGAAATC -3'
Posted On2019-06-07