Incidental Mutation 'PIT4812001:Dscc1'
List |< first << previous [record 17 of 62] next >> last >|
ID556934
Institutional Source Beutler Lab
Gene Symbol Dscc1
Ensembl Gene ENSMUSG00000022422
Gene NameDNA replication and sister chromatid cohesion 1
Synonyms2600005O03Rik, 2010006I05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #PIT4812001 (G1)
Quality Score177.009
Status Not validated
Chromosome15
Chromosomal Location55076099-55090491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55082261 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 346 (L346P)
Ref Sequence ENSEMBL: ENSMUSP00000105860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023059] [ENSMUST00000110231]
Predicted Effect probably damaging
Transcript: ENSMUST00000023059
AA Change: L283P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023059
Gene: ENSMUSG00000022422
AA Change: L283P

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 48 364 7.3e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110231
AA Change: L346P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105860
Gene: ENSMUSG00000022422
AA Change: L346P

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 49 271 5.9e-62 PFAM
Pfam:DUF2036 284 426 4.3e-38 PFAM
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CHTF18 (MIM 613201), CHTF8 (MIM 613202), and DSCC1 are components of an alternative replication factor C (RFC) (see MIM 600404) complex that loads PCNA (MIM 176740) onto DNA during S phase of the cell cycle (Merkle et al., 2003 [PubMed 12766176]; Bermudez et al., 2003 [PubMed 12930902]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Dscc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Dscc1 APN 15 55082325 splice site probably benign
IGL01879:Dscc1 APN 15 55086816 missense probably benign 0.21
BB001:Dscc1 UTSW 15 55082176 missense probably benign 0.03
BB011:Dscc1 UTSW 15 55082176 missense probably benign 0.03
PIT4498001:Dscc1 UTSW 15 55082315 missense probably benign 0.00
R0106:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R0106:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R0594:Dscc1 UTSW 15 55089052 missense possibly damaging 0.69
R0616:Dscc1 UTSW 15 55083570 missense probably benign 0.10
R1458:Dscc1 UTSW 15 55086764 missense probably damaging 1.00
R1498:Dscc1 UTSW 15 55080176 splice site probably benign
R1763:Dscc1 UTSW 15 55080176 splice site probably benign
R1763:Dscc1 UTSW 15 55084139 missense probably damaging 0.98
R1985:Dscc1 UTSW 15 55080176 splice site probably benign
R2418:Dscc1 UTSW 15 55083424 nonsense probably null
R2419:Dscc1 UTSW 15 55083424 nonsense probably null
R3955:Dscc1 UTSW 15 55083553 missense probably benign 0.05
R4773:Dscc1 UTSW 15 55080258 missense probably benign 0.01
R5611:Dscc1 UTSW 15 55082173 missense probably benign 0.23
R6484:Dscc1 UTSW 15 55080290 nonsense probably null
R7562:Dscc1 UTSW 15 55084185 missense probably benign 0.15
R7662:Dscc1 UTSW 15 55076165 missense possibly damaging 0.95
R7924:Dscc1 UTSW 15 55082176 missense probably benign 0.03
Z1088:Dscc1 UTSW 15 55080317 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TCAGCTCCAGGACAAGGATCAC -3'
(R):5'- CAATACAGTGGCAGTGAGGC -3'

Sequencing Primer
(F):5'- GATCACCTCCCCTGGTCAGAC -3'
(R):5'- TTTAGCCCTGCTACAAGGTGAGAAC -3'
Posted On2019-06-07