Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4812001:Smc1b'

556936

Institutional Source

Beutler Lab

Gene Symbol

Smc1b

Ensembl Gene

ENSMUSG00000022432

Gene Name

structural maintenance of chromosomes 1B

Synonyms

SMC1beta, Smc1l2

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.691) question?

Stock #

PIT4812001 (G1)

Quality Score

147.008

Status

Not validated

Chromosome

Chromosomal Location

85064689-85131964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85069651 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1139 (V1139A)

Ref Sequence

ENSEMBL: ENSMUSP00000023068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000227591]

AlphaFold

Q920F6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023068
AA Change: V1139A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: V1139A

Domain	Start	End	E-Value	Type
Pfam:AAA_23	7	361	2e-10	PFAM
Pfam:AAA_21	27	372	7.2e-9	PFAM
low complexity region	422	437	N/A	INTRINSIC
SMC_hinge	513	629	1.5e-23	SMART
PDB:1W1W\|D	1046	1218	3e-42	PDB
Blast:AAA	1063	1217	5e-25	BLAST
SCOP:d1e69a_	1114	1202	3e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227591

Coding Region Coverage

1x: 93.8%
3x: 91.0%
10x: 85.3%
20x: 73.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	T	C	18: 6,630,053	S252P	possibly damaging	Het
4933409G03Rik	G	A	2: 68,588,948	V14I	probably benign	Het
Adgrf5	T	G	17: 43,450,369	V985G	probably damaging	Het
Ankrd44	A	T	1: 54,723,038	Y542*	probably null	Het
Atp13a3	T	C	16: 30,362,578	T75A	probably damaging	Het
Atr	T	C	9: 95,910,649	F1675L	probably benign	Het
Atrnl1	A	G	19: 57,731,623	I1082V	probably benign	Het
C87977	A	G	4: 144,209,516	I56T	probably benign	Het
Clip1	T	A	5: 123,630,675	R620S	probably benign	Het
Cped1	T	C	6: 22,122,294	F391S	probably benign	Het
Cracr2a	T	C	6: 127,625,870	L230P	probably damaging	Het
Dctn1	T	A	6: 83,199,762	V1266E	possibly damaging	Het
Dlg1	T	A	16: 31,846,885	F687I	probably benign	Het
Dnah8	C	A	17: 30,708,445	D1358E	probably benign	Het
Dnajc11	A	G	4: 151,952,889	R84G	probably benign	Het
Dnajc14	C	A	10: 128,806,683	T158N	probably damaging	Het
Dscc1	A	G	15: 55,082,261	L346P	probably damaging	Het
Efcab3	A	G	11: 105,099,979	I71V	probably null	Het
Erbb3	T	A	10: 128,574,379	Q670L	possibly damaging	Het
Ercc4	G	A	16: 13,144,447	E652K	probably benign	Het
Ercc6l2	T	A	13: 63,858,257	V591D	possibly damaging	Het
Fam126b	T	G	1: 58,548,703	D117A	possibly damaging	Het
Fam3c	C	T	6: 22,321,370	G134E	probably damaging	Het
Frmd5	A	G	2: 121,586,446	V70A	probably benign	Het
Gjc1	A	T	11: 102,800,981	Y65*	probably null	Het
Gm3033	A	C	14: 3,848,891	L137F		Het
Gria4	C	A	9: 4,427,128	A771S	probably damaging	Het
Hc	A	G	2: 35,029,452	L674P	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Inpp5f	A	T	7: 128,692,308	Y696F	probably benign	Het
Itga11	C	A	9: 62,732,193	Q157K	probably damaging	Het
Itgb5	G	T	16: 33,919,987	C489F	probably damaging	Het
Klhl38	C	T	15: 58,322,542	G264S	probably benign	Het
Krt78	C	T	15: 101,948,069	V436M	probably damaging	Het
Mia2	A	T	12: 59,101,579	D75V	possibly damaging	Het
Mphosph6	T	A	8: 117,799,149	Q20L	probably damaging	Het
Ogfr	C	T	2: 180,595,511	P630S	possibly damaging	Het
Olfr1206	G	A	2: 88,864,970	V122M	probably benign	Het
Olfr1431	T	G	19: 12,210,253	I229S	probably damaging	Het
Olfr15	A	T	16: 3,839,530	K186*	probably null	Het
Pbx3	T	C	2: 34,224,619	E101G	probably damaging	Het
Pcca	T	A	14: 122,790,382	N587K	probably benign	Het
Pdia3	G	T	2: 121,433,530	A287S	probably damaging	Het
Pfas	T	A	11: 68,990,036	D209V		Het
Pter	A	T	2: 12,980,368	I170F	probably damaging	Het
Ptprq	A	T	10: 107,666,567	V830E	probably damaging	Het
Rab11fip5	T	C	6: 85,341,558	D783G	probably benign	Het
Rbm19	T	C	5: 120,128,250	V446A	possibly damaging	Het
Selp	A	G	1: 164,132,263	N363D	probably benign	Het
Six2	C	A	17: 85,685,301	S258I	possibly damaging	Het
Sp1	A	G	15: 102,408,408	T121A	possibly damaging	Het
Sucla2	A	T	14: 73,579,449	I210L	possibly damaging	Het
Trank1	T	C	9: 111,347,912	L339P	probably damaging	Het
Ttll5	T	A	12: 85,926,861	D794E	probably benign	Het
Usp32	C	T	11: 85,010,074	V1107I	probably damaging	Het
Vmn1r195	T	C	13: 22,278,863	Y168H	probably benign	Het
Vmn1r223	A	G	13: 23,249,890	N218S	probably damaging	Het
Vmn2r25	T	A	6: 123,823,488	S632C	probably damaging	Het
Vwa3a	A	T	7: 120,776,133	K390I	probably damaging	Het
Zfp442	A	T	2: 150,409,741	C80*	probably null	Het
Zic1	A	T	9: 91,364,341	I226N	probably damaging	Het

Other mutations in Smc1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00736:Smc1b	APN	15	85129700	missense	possibly damaging	0.95
IGL01293:Smc1b	APN	15	85131898	missense	probably damaging	1.00
IGL01656:Smc1b	APN	15	85114776	missense	probably damaging	0.99
IGL01807:Smc1b	APN	15	85096745	missense	probably damaging	0.97
IGL02094:Smc1b	APN	15	85097891	splice site	probably benign
IGL02121:Smc1b	APN	15	85097985	missense	probably benign
IGL02631:Smc1b	APN	15	85107003	missense	probably damaging	0.98
IGL02678:Smc1b	APN	15	85065000	nonsense	probably null
IGL03197:Smc1b	APN	15	85070863	missense	possibly damaging	0.85
IGL03214:Smc1b	APN	15	85097946	nonsense	probably null
IGL03218:Smc1b	APN	15	85089713	missense	probably benign	0.07
IGL03232:Smc1b	APN	15	85129720	missense	possibly damaging	0.68
adamantine	UTSW	15	85121641	missense	probably benign	0.06
unbreakable	UTSW	15	85096658	missense	probably benign
E0370:Smc1b	UTSW	15	85127581	missense	probably damaging	1.00
R0092:Smc1b	UTSW	15	85067724	unclassified	probably benign
R0106:Smc1b	UTSW	15	85070819	missense	probably damaging	1.00
R0106:Smc1b	UTSW	15	85070819	missense	probably damaging	1.00
R0207:Smc1b	UTSW	15	85123759	missense	probably benign
R0390:Smc1b	UTSW	15	85066277	missense	probably damaging	1.00
R0440:Smc1b	UTSW	15	85112673	splice site	probably benign
R0685:Smc1b	UTSW	15	85070820	missense	possibly damaging	0.92
R1109:Smc1b	UTSW	15	85112815	missense	probably damaging	0.98
R1392:Smc1b	UTSW	15	85107070	splice site	probably benign
R1509:Smc1b	UTSW	15	85086134	missense	probably benign
R1804:Smc1b	UTSW	15	85127790	missense	possibly damaging	0.90
R1879:Smc1b	UTSW	15	85092067	missense	probably benign	0.01
R2086:Smc1b	UTSW	15	85121851	splice site	probably benign
R2143:Smc1b	UTSW	15	85123802	missense	probably benign
R2158:Smc1b	UTSW	15	85121851	splice site	probably benign
R2174:Smc1b	UTSW	15	85121851	splice site	probably benign
R2471:Smc1b	UTSW	15	85092017	missense	probably damaging	0.98
R3689:Smc1b	UTSW	15	85117263	intron	probably benign
R3690:Smc1b	UTSW	15	85117263	intron	probably benign
R4178:Smc1b	UTSW	15	85120647	missense	possibly damaging	0.94
R4420:Smc1b	UTSW	15	85112830	missense	probably damaging	1.00
R4905:Smc1b	UTSW	15	85066227	missense	probably damaging	1.00
R4919:Smc1b	UTSW	15	85117104	intron	probably benign
R5114:Smc1b	UTSW	15	85064984	missense	probably damaging	1.00
R5314:Smc1b	UTSW	15	85070865	missense	probably benign	0.00
R5476:Smc1b	UTSW	15	85086151	missense	probably damaging	0.97
R5593:Smc1b	UTSW	15	85121641	missense	probably benign	0.06
R5690:Smc1b	UTSW	15	85112773	missense	probably damaging	1.00
R5719:Smc1b	UTSW	15	85096658	missense	probably benign
R5817:Smc1b	UTSW	15	85067783	missense	probably damaging	0.99
R5834:Smc1b	UTSW	15	85089665	missense	probably damaging	1.00
R5930:Smc1b	UTSW	15	85086121	missense	probably damaging	1.00
R6032:Smc1b	UTSW	15	85066229	missense	possibly damaging	0.92
R6032:Smc1b	UTSW	15	85066229	missense	possibly damaging	0.92
R6049:Smc1b	UTSW	15	85121695	missense	probably damaging	1.00
R6306:Smc1b	UTSW	15	85127623	missense	probably benign	0.30
R6392:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6426:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6435:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6436:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6437:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6508:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6512:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6703:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6737:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6775:Smc1b	UTSW	15	85089680	missense	probably damaging	0.96
R6889:Smc1b	UTSW	15	85067759	missense	probably damaging	1.00
R6908:Smc1b	UTSW	15	85107010	missense	probably damaging	1.00
R7124:Smc1b	UTSW	15	85071597	missense	probably damaging	0.98
R7400:Smc1b	UTSW	15	85069720	missense	probably damaging	1.00
R7417:Smc1b	UTSW	15	85097542	missense	probably benign	0.05
R7610:Smc1b	UTSW	15	85070820	missense	possibly damaging	0.92
R7873:Smc1b	UTSW	15	85110650	critical splice donor site	probably null
R7890:Smc1b	UTSW	15	85066328	missense	probably damaging	1.00
R8004:Smc1b	UTSW	15	85097614	missense	probably damaging	0.98
R8698:Smc1b	UTSW	15	85112846	missense	probably benign	0.16
R8826:Smc1b	UTSW	15	85066328	missense	probably damaging	1.00
R8835:Smc1b	UTSW	15	85129748	missense	possibly damaging	0.83
R8925:Smc1b	UTSW	15	85107072	splice site	probably null
R9059:Smc1b	UTSW	15	85120674	nonsense	probably null
R9149:Smc1b	UTSW	15	85066230	missense	probably benign	0.00
R9241:Smc1b	UTSW	15	85092008	missense	probably benign	0.00
R9245:Smc1b	UTSW	15	85120645	missense	probably benign	0.03
R9301:Smc1b	UTSW	15	85127794	missense	probably damaging	0.98
R9384:Smc1b	UTSW	15	85066254	missense	probably damaging	0.99
R9750:Smc1b	UTSW	15	85131905	missense	probably damaging	1.00
Z1176:Smc1b	UTSW	15	85131903	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAGAAAACTACTAGCTATTGCCAG -3'
(R):5'- TGCACAACTAAGTGGATTTACAGG -3'

Sequencing Primer
(F):5'- TGCCAGATTTTATCAAAGACTGTAC -3'
(R):5'- GCCACCTAACATATATTGGTTACTC -3'

Posted On

2019-06-07