Incidental Mutation 'PIT4812001:Smc1b'
ID 556936
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Name structural maintenance of chromosomes 1B
Synonyms Smc1l2, SMC1beta
Accession Numbers
Essential gene? Possibly essential (E-score: 0.696) question?
Stock # PIT4812001 (G1)
Quality Score 147.008
Status Not validated
Chromosome 15
Chromosomal Location 84948890-85016158 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84953852 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1139 (V1139A)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000227591]
AlphaFold Q920F6
Predicted Effect possibly damaging
Transcript: ENSMUST00000023068
AA Change: V1139A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: V1139A

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227591
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 (GRCm39) S252P possibly damaging Het
4933409G03Rik G A 2: 68,419,292 (GRCm39) V14I probably benign Het
Adgrf5 T G 17: 43,761,260 (GRCm39) V985G probably damaging Het
Ankrd44 A T 1: 54,762,197 (GRCm39) Y542* probably null Het
Atp13a3 T C 16: 30,181,396 (GRCm39) T75A probably damaging Het
Atr T C 9: 95,792,702 (GRCm39) F1675L probably benign Het
Atrnl1 A G 19: 57,720,055 (GRCm39) I1082V probably benign Het
Clip1 T A 5: 123,768,738 (GRCm39) R620S probably benign Het
Cped1 T C 6: 22,122,293 (GRCm39) F391S probably benign Het
Cracr2a T C 6: 127,602,833 (GRCm39) L230P probably damaging Het
Dctn1 T A 6: 83,176,744 (GRCm39) V1266E possibly damaging Het
Dlg1 T A 16: 31,665,703 (GRCm39) F687I probably benign Het
Dnah8 C A 17: 30,927,419 (GRCm39) D1358E probably benign Het
Dnajc11 A G 4: 152,037,346 (GRCm39) R84G probably benign Het
Dnajc14 C A 10: 128,642,552 (GRCm39) T158N probably damaging Het
Dscc1 A G 15: 54,945,657 (GRCm39) L346P probably damaging Het
Efcab3 A G 11: 104,990,805 (GRCm39) I71V probably null Het
Erbb3 T A 10: 128,410,248 (GRCm39) Q670L possibly damaging Het
Ercc4 G A 16: 12,962,311 (GRCm39) E652K probably benign Het
Ercc6l2 T A 13: 64,006,071 (GRCm39) V591D possibly damaging Het
Fam3c C T 6: 22,321,369 (GRCm39) G134E probably damaging Het
Frmd5 A G 2: 121,416,927 (GRCm39) V70A probably benign Het
Gjd3 A T 11: 102,691,807 (GRCm39) Y65* probably null Het
Gm3033 A C 14: 3,848,891 (GRCm38) L137F Het
Gria4 C A 9: 4,427,128 (GRCm39) A771S probably damaging Het
Hc A G 2: 34,919,464 (GRCm39) L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hycc2 T G 1: 58,587,862 (GRCm39) D117A possibly damaging Het
Inpp5f A T 7: 128,294,032 (GRCm39) Y696F probably benign Het
Itga11 C A 9: 62,639,475 (GRCm39) Q157K probably damaging Het
Itgb5 G T 16: 33,740,357 (GRCm39) C489F probably damaging Het
Klhl38 C T 15: 58,185,938 (GRCm39) G264S probably benign Het
Krt78 C T 15: 101,856,504 (GRCm39) V436M probably damaging Het
Mia2 A T 12: 59,148,365 (GRCm39) D75V possibly damaging Het
Mphosph6 T A 8: 118,525,888 (GRCm39) Q20L probably damaging Het
Ogfr C T 2: 180,237,304 (GRCm39) P630S possibly damaging Het
Or2c1 A T 16: 3,657,394 (GRCm39) K186* probably null Het
Or4c11 G A 2: 88,695,314 (GRCm39) V122M probably benign Het
Or5an9 T G 19: 12,187,617 (GRCm39) I229S probably damaging Het
Pbx3 T C 2: 34,114,631 (GRCm39) E101G probably damaging Het
Pcca T A 14: 123,027,794 (GRCm39) N587K probably benign Het
Pdia3 G T 2: 121,264,011 (GRCm39) A287S probably damaging Het
Pfas T A 11: 68,880,862 (GRCm39) D209V Het
Pramel29 A G 4: 143,936,086 (GRCm39) I56T probably benign Het
Pter A T 2: 12,985,179 (GRCm39) I170F probably damaging Het
Ptprq A T 10: 107,502,428 (GRCm39) V830E probably damaging Het
Rab11fip5 T C 6: 85,318,540 (GRCm39) D783G probably benign Het
Rbm19 T C 5: 120,266,315 (GRCm39) V446A possibly damaging Het
Selp A G 1: 163,959,832 (GRCm39) N363D probably benign Het
Six2 C A 17: 85,992,729 (GRCm39) S258I possibly damaging Het
Sp1 A G 15: 102,316,843 (GRCm39) T121A possibly damaging Het
Sucla2 A T 14: 73,816,889 (GRCm39) I210L possibly damaging Het
Trank1 T C 9: 111,176,980 (GRCm39) L339P probably damaging Het
Ttll5 T A 12: 85,973,635 (GRCm39) D794E probably benign Het
Usp32 C T 11: 84,900,900 (GRCm39) V1107I probably damaging Het
Vmn1r195 T C 13: 22,463,033 (GRCm39) Y168H probably benign Het
Vmn1r223 A G 13: 23,434,060 (GRCm39) N218S probably damaging Het
Vmn2r25 T A 6: 123,800,447 (GRCm39) S632C probably damaging Het
Vwa3a A T 7: 120,375,356 (GRCm39) K390I probably damaging Het
Zfp442 A T 2: 150,251,661 (GRCm39) C80* probably null Het
Zic1 A T 9: 91,246,394 (GRCm39) I226N probably damaging Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85,013,901 (GRCm39) missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85,016,099 (GRCm39) missense probably damaging 1.00
IGL01656:Smc1b APN 15 84,998,977 (GRCm39) missense probably damaging 0.99
IGL01807:Smc1b APN 15 84,980,946 (GRCm39) missense probably damaging 0.97
IGL02094:Smc1b APN 15 84,982,092 (GRCm39) splice site probably benign
IGL02121:Smc1b APN 15 84,982,186 (GRCm39) missense probably benign
IGL02631:Smc1b APN 15 84,991,204 (GRCm39) missense probably damaging 0.98
IGL02678:Smc1b APN 15 84,949,201 (GRCm39) nonsense probably null
IGL03197:Smc1b APN 15 84,955,064 (GRCm39) missense possibly damaging 0.85
IGL03214:Smc1b APN 15 84,982,147 (GRCm39) nonsense probably null
IGL03218:Smc1b APN 15 84,973,914 (GRCm39) missense probably benign 0.07
IGL03232:Smc1b APN 15 85,013,921 (GRCm39) missense possibly damaging 0.68
adamantine UTSW 15 85,005,842 (GRCm39) missense probably benign 0.06
unbreakable UTSW 15 84,980,859 (GRCm39) missense probably benign
E0370:Smc1b UTSW 15 85,011,782 (GRCm39) missense probably damaging 1.00
R0092:Smc1b UTSW 15 84,951,925 (GRCm39) unclassified probably benign
R0106:Smc1b UTSW 15 84,955,020 (GRCm39) missense probably damaging 1.00
R0106:Smc1b UTSW 15 84,955,020 (GRCm39) missense probably damaging 1.00
R0207:Smc1b UTSW 15 85,007,960 (GRCm39) missense probably benign
R0390:Smc1b UTSW 15 84,950,478 (GRCm39) missense probably damaging 1.00
R0440:Smc1b UTSW 15 84,996,874 (GRCm39) splice site probably benign
R0685:Smc1b UTSW 15 84,955,021 (GRCm39) missense possibly damaging 0.92
R1109:Smc1b UTSW 15 84,997,016 (GRCm39) missense probably damaging 0.98
R1392:Smc1b UTSW 15 84,991,271 (GRCm39) splice site probably benign
R1509:Smc1b UTSW 15 84,970,335 (GRCm39) missense probably benign
R1804:Smc1b UTSW 15 85,011,991 (GRCm39) missense possibly damaging 0.90
R1879:Smc1b UTSW 15 84,976,268 (GRCm39) missense probably benign 0.01
R2086:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2143:Smc1b UTSW 15 85,008,003 (GRCm39) missense probably benign
R2158:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2174:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2471:Smc1b UTSW 15 84,976,218 (GRCm39) missense probably damaging 0.98
R3689:Smc1b UTSW 15 85,001,464 (GRCm39) intron probably benign
R3690:Smc1b UTSW 15 85,001,464 (GRCm39) intron probably benign
R4178:Smc1b UTSW 15 85,004,848 (GRCm39) missense possibly damaging 0.94
R4420:Smc1b UTSW 15 84,997,031 (GRCm39) missense probably damaging 1.00
R4905:Smc1b UTSW 15 84,950,428 (GRCm39) missense probably damaging 1.00
R4919:Smc1b UTSW 15 85,001,305 (GRCm39) intron probably benign
R5114:Smc1b UTSW 15 84,949,185 (GRCm39) missense probably damaging 1.00
R5314:Smc1b UTSW 15 84,955,066 (GRCm39) missense probably benign 0.00
R5476:Smc1b UTSW 15 84,970,352 (GRCm39) missense probably damaging 0.97
R5593:Smc1b UTSW 15 85,005,842 (GRCm39) missense probably benign 0.06
R5690:Smc1b UTSW 15 84,996,974 (GRCm39) missense probably damaging 1.00
R5719:Smc1b UTSW 15 84,980,859 (GRCm39) missense probably benign
R5817:Smc1b UTSW 15 84,951,984 (GRCm39) missense probably damaging 0.99
R5834:Smc1b UTSW 15 84,973,866 (GRCm39) missense probably damaging 1.00
R5930:Smc1b UTSW 15 84,970,322 (GRCm39) missense probably damaging 1.00
R6032:Smc1b UTSW 15 84,950,430 (GRCm39) missense possibly damaging 0.92
R6032:Smc1b UTSW 15 84,950,430 (GRCm39) missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85,005,896 (GRCm39) missense probably damaging 1.00
R6306:Smc1b UTSW 15 85,011,824 (GRCm39) missense probably benign 0.30
R6392:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6426:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6435:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6436:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6437:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6508:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6512:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6703:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6737:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6775:Smc1b UTSW 15 84,973,881 (GRCm39) missense probably damaging 0.96
R6889:Smc1b UTSW 15 84,951,960 (GRCm39) missense probably damaging 1.00
R6908:Smc1b UTSW 15 84,991,211 (GRCm39) missense probably damaging 1.00
R7124:Smc1b UTSW 15 84,955,798 (GRCm39) missense probably damaging 0.98
R7400:Smc1b UTSW 15 84,953,921 (GRCm39) missense probably damaging 1.00
R7417:Smc1b UTSW 15 84,981,743 (GRCm39) missense probably benign 0.05
R7610:Smc1b UTSW 15 84,955,021 (GRCm39) missense possibly damaging 0.92
R7873:Smc1b UTSW 15 84,994,851 (GRCm39) critical splice donor site probably null
R7890:Smc1b UTSW 15 84,950,529 (GRCm39) missense probably damaging 1.00
R8004:Smc1b UTSW 15 84,981,815 (GRCm39) missense probably damaging 0.98
R8698:Smc1b UTSW 15 84,997,047 (GRCm39) missense probably benign 0.16
R8826:Smc1b UTSW 15 84,950,529 (GRCm39) missense probably damaging 1.00
R8835:Smc1b UTSW 15 85,013,949 (GRCm39) missense possibly damaging 0.83
R8925:Smc1b UTSW 15 84,991,273 (GRCm39) splice site probably null
R9059:Smc1b UTSW 15 85,004,875 (GRCm39) nonsense probably null
R9149:Smc1b UTSW 15 84,950,431 (GRCm39) missense probably benign 0.00
R9241:Smc1b UTSW 15 84,976,209 (GRCm39) missense probably benign 0.00
R9245:Smc1b UTSW 15 85,004,846 (GRCm39) missense probably benign 0.03
R9301:Smc1b UTSW 15 85,011,995 (GRCm39) missense probably damaging 0.98
R9384:Smc1b UTSW 15 84,950,455 (GRCm39) missense probably damaging 0.99
R9750:Smc1b UTSW 15 85,016,106 (GRCm39) missense probably damaging 1.00
Z1176:Smc1b UTSW 15 85,016,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGAAAACTACTAGCTATTGCCAG -3'
(R):5'- TGCACAACTAAGTGGATTTACAGG -3'

Sequencing Primer
(F):5'- TGCCAGATTTTATCAAAGACTGTAC -3'
(R):5'- GCCACCTAACATATATTGGTTACTC -3'
Posted On 2019-06-07