Incidental Mutation 'PIT4812001:Sp1'
ID556938
Institutional Source Beutler Lab
Gene Symbol Sp1
Ensembl Gene ENSMUSG00000001280
Gene Nametrans-acting transcription factor 1
SynonymsSp1-1, 1110003E12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4812001 (G1)
Quality Score193.009
Status Not validated
Chromosome15
Chromosomal Location102406143-102436404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102408408 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 121 (T121A)
Ref Sequence ENSEMBL: ENSMUSP00000001326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001326] [ENSMUST00000163709] [ENSMUST00000165837] [ENSMUST00000168802] [ENSMUST00000169619] [ENSMUST00000170884]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001326
AA Change: T121A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001326
Gene: ENSMUSG00000001280
AA Change: T121A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 37 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 279 296 N/A INTRINSIC
low complexity region 300 333 N/A INTRINSIC
low complexity region 341 354 N/A INTRINSIC
low complexity region 370 422 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
ZnF_C2H2 624 648 4.34e0 SMART
ZnF_C2H2 654 678 1.98e-4 SMART
ZnF_C2H2 684 706 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163709
SMART Domains Protein: ENSMUSP00000130747
Gene: ENSMUSG00000001280

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 37 108 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
ZnF_C2H2 310 334 4.34e0 SMART
ZnF_C2H2 340 364 1.98e-4 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165837
AA Change: T114A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126143
Gene: ENSMUSG00000001280
AA Change: T114A

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168802
SMART Domains Protein: ENSMUSP00000127445
Gene: ENSMUSG00000001280

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169619
SMART Domains Protein: ENSMUSP00000127714
Gene: ENSMUSG00000001280

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170884
SMART Domains Protein: ENSMUSP00000129638
Gene: ENSMUSG00000001280

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to GC-rich motifs of many promoters. The encoded protein is involved in many cellular processes, including cell differentiation, cell growth, apoptosis, immune responses, response to DNA damage, and chromatin remodeling. Post-translational modifications such as phosphorylation, acetylation, glycosylation, and proteolytic processing significantly affect the activity of this protein, which can be an activator or a repressor. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display reduced embryo size and die during organogenesis with a broad range of developmental defects. Heterozygous null mice are viable but slightly growth retarded, may lack one or both eyes, and show a decreased erythroid progenitor cell number in fetal liver cultures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Sp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Sp1 APN 15 102430929 missense probably damaging 1.00
R0758:Sp1 UTSW 15 102406370 splice site probably null
R1509:Sp1 UTSW 15 102407879 missense possibly damaging 0.66
R1611:Sp1 UTSW 15 102430935 missense probably damaging 0.99
R1820:Sp1 UTSW 15 102409076 missense possibly damaging 0.73
R1824:Sp1 UTSW 15 102431003 missense possibly damaging 0.70
R2107:Sp1 UTSW 15 102409678 splice site probably null
R4508:Sp1 UTSW 15 102409312 missense possibly damaging 0.53
R4857:Sp1 UTSW 15 102430974 missense probably damaging 0.99
R5512:Sp1 UTSW 15 102431010 missense possibly damaging 0.91
R5559:Sp1 UTSW 15 102408930 missense probably benign 0.18
R5833:Sp1 UTSW 15 102430917 missense possibly damaging 0.92
R6377:Sp1 UTSW 15 102430883 missense probably benign 0.13
R8059:Sp1 UTSW 15 102407902 missense possibly damaging 0.73
R8434:Sp1 UTSW 15 102409683 missense probably benign 0.00
R8537:Sp1 UTSW 15 102408529 missense possibly damaging 0.86
X0050:Sp1 UTSW 15 102409411 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTCTTCTGGCCAGGAATC -3'
(R):5'- TGCTGCCCATCAACAGTCTG -3'

Sequencing Primer
(F):5'- TTCTGGCCAGGAATCCCAGC -3'
(R):5'- CTGGAACTGTGGGATTACTTGATAC -3'
Posted On2019-06-07