Incidental Mutation 'PIT4812001:Ercc4'
ID556940
Institutional Source Beutler Lab
Gene Symbol Ercc4
Ensembl Gene ENSMUSG00000022545
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 4
SynonymsXpf
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location13109684-13150617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13144447 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 652 (E652K)
Ref Sequence ENSEMBL: ENSMUSP00000023206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023206] [ENSMUST00000129049]
Predicted Effect probably benign
Transcript: ENSMUST00000023206
AA Change: E652K

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023206
Gene: ENSMUSG00000022545
AA Change: E652K

DomainStartEndE-ValueType
Blast:DEXDc 8 187 1e-5 BLAST
ERCC4 684 764 1.11e-26 SMART
low complexity region 789 802 N/A INTRINSIC
PDB:2AQ0|B 835 917 6e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000129049
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice show impaired growth and do not survive longer than several weeks of age. Cultutred cells obtained from mutant mice were shown to be hypersensitive to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Ercc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Ercc4 APN 16 13125369 missense possibly damaging 0.91
IGL00805:Ercc4 APN 16 13122004 missense possibly damaging 0.77
IGL01348:Ercc4 APN 16 13132934 missense probably damaging 1.00
IGL02406:Ercc4 APN 16 13123536 missense probably damaging 1.00
IGL03248:Ercc4 APN 16 13127593 missense probably damaging 1.00
Rapscallion UTSW 16 13126467 missense probably benign
Rascal UTSW 16 13132947 missense probably damaging 1.00
R0212:Ercc4 UTSW 16 13123332 critical splice acceptor site probably null
R0505:Ercc4 UTSW 16 13126467 missense probably benign
R0962:Ercc4 UTSW 16 13130146 missense probably damaging 0.99
R1078:Ercc4 UTSW 16 13130197 missense probably benign 0.00
R1356:Ercc4 UTSW 16 13125282 missense probably damaging 0.99
R1420:Ercc4 UTSW 16 13130209 missense probably benign 0.01
R1554:Ercc4 UTSW 16 13147622 missense probably damaging 1.00
R1899:Ercc4 UTSW 16 13147787 missense probably damaging 1.00
R2128:Ercc4 UTSW 16 13147934 missense probably damaging 0.99
R2214:Ercc4 UTSW 16 13110024 missense probably damaging 1.00
R3757:Ercc4 UTSW 16 13144496 missense probably benign 0.28
R4072:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4073:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4075:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4076:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4646:Ercc4 UTSW 16 13147574 missense probably damaging 1.00
R4731:Ercc4 UTSW 16 13147607 missense probably damaging 1.00
R4756:Ercc4 UTSW 16 13123423 missense probably damaging 1.00
R4767:Ercc4 UTSW 16 13122095 missense probably damaging 1.00
R5011:Ercc4 UTSW 16 13123581 intron probably benign
R5013:Ercc4 UTSW 16 13123581 intron probably benign
R5301:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R5308:Ercc4 UTSW 16 13130164 missense probably damaging 1.00
R5684:Ercc4 UTSW 16 13130601 missense probably benign 0.35
R6083:Ercc4 UTSW 16 13110039 nonsense probably null
R6092:Ercc4 UTSW 16 13125261 missense probably benign 0.04
R6815:Ercc4 UTSW 16 13123435 missense probably damaging 0.99
R6953:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R7062:Ercc4 UTSW 16 13132947 missense probably damaging 1.00
R7199:Ercc4 UTSW 16 13147793 missense probably damaging 1.00
R7317:Ercc4 UTSW 16 13122113 missense probably benign 0.12
R7858:Ercc4 UTSW 16 13125305 missense probably damaging 0.98
R7948:Ercc4 UTSW 16 13130185 missense probably benign 0.00
R8245:Ercc4 UTSW 16 13130137 missense probably benign 0.00
R8408:Ercc4 UTSW 16 13130137 missense probably benign 0.00
R8409:Ercc4 UTSW 16 13130137 missense probably benign 0.00
RF007:Ercc4 UTSW 16 13123507 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACCCTCCAGTCATGTATCAGAG -3'
(R):5'- CTTGCCTGATTCATGGTTTTAAGAG -3'

Sequencing Primer
(F):5'- GTCATGTATCAGAGACAATCCTCCTG -3'
(R):5'- CTACATAGTGAGTTCCCGGATAGC -3'
Posted On2019-06-07