Incidental Mutation 'PIT4812001:Dlg1'
ID556942
Institutional Source Beutler Lab
Gene Symbol Dlg1
Ensembl Gene ENSMUSG00000022770
Gene Namediscs large MAGUK scaffold protein 1
SynonymsDlgh1, B130052P05Rik, SAP97
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location31663443-31875129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31846885 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 687 (F687I)
Ref Sequence ENSEMBL: ENSMUSP00000064280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023454] [ENSMUST00000064477] [ENSMUST00000100001] [ENSMUST00000115196] [ENSMUST00000115201] [ENSMUST00000115205] [ENSMUST00000132176]
Predicted Effect probably benign
Transcript: ENSMUST00000023454
SMART Domains Protein: ENSMUSP00000023454
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 441 514 1.84e-22 SMART
low complexity region 534 542 N/A INTRINSIC
SH3 551 617 1.27e-9 SMART
GuKc 681 860 1.54e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064477
AA Change: F687I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064280
Gene: ENSMUSG00000022770
AA Change: F687I

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 736 915 1.54e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100001
SMART Domains Protein: ENSMUSP00000097581
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115196
SMART Domains Protein: ENSMUSP00000110850
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
MAGUK_N_PEST 30 140 1.81e-14 SMART
PDZ 149 228 5.98e-22 SMART
PDZ 244 323 1.94e-21 SMART
PDZ 391 464 1.84e-22 SMART
low complexity region 484 492 N/A INTRINSIC
SH3 501 567 1.27e-9 SMART
GuKc 643 822 1.54e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115201
SMART Domains Protein: ENSMUSP00000110855
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 721 900 1.54e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115205
SMART Domains Protein: ENSMUSP00000110859
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130920
Predicted Effect probably benign
Transcript: ENSMUST00000131136
SMART Domains Protein: ENSMUSP00000115954
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
PDZ 38 117 1.94e-21 SMART
PDZ 170 243 1.84e-22 SMART
low complexity region 263 271 N/A INTRINSIC
SH3 280 346 1.27e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132176
SMART Domains Protein: ENSMUSP00000138782
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 426 499 1.84e-22 SMART
low complexity region 519 527 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain scaffolding protein that is required for normal development. This protein may have a role in septate junction formation, signal transduction, cell proliferation, synaptogenesis and lymphocyte activation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene, but the full-length nature of some of the variants is not known. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal lethality, craniofacial defects, and abnormal eye morphology. Mice homozygous for knock-out alleles exhibit neonatal lethality, kidney defects, reproductive organ morphology, and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Dlg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Dlg1 APN 16 31856438 splice site probably benign
IGL02277:Dlg1 APN 16 31790264 missense probably damaging 1.00
IGL02897:Dlg1 APN 16 31771856 critical splice donor site probably null
IGL03025:Dlg1 APN 16 31805727 missense probably benign 0.00
IGL03271:Dlg1 APN 16 31857892 missense possibly damaging 0.94
R0068:Dlg1 UTSW 16 31836200 unclassified probably benign
R0115:Dlg1 UTSW 16 31805690 nonsense probably null
R0128:Dlg1 UTSW 16 31858065 critical splice donor site probably null
R0257:Dlg1 UTSW 16 31842853 splice site probably benign
R0268:Dlg1 UTSW 16 31684193 missense probably benign
R0312:Dlg1 UTSW 16 31790267 missense probably benign
R0321:Dlg1 UTSW 16 31858036 missense probably damaging 1.00
R0355:Dlg1 UTSW 16 31684174 nonsense probably null
R0538:Dlg1 UTSW 16 31796864 critical splice acceptor site probably null
R0540:Dlg1 UTSW 16 31838174 missense possibly damaging 0.90
R0607:Dlg1 UTSW 16 31665580 missense probably benign 0.37
R0607:Dlg1 UTSW 16 31838174 missense possibly damaging 0.90
R0894:Dlg1 UTSW 16 31743147 missense probably benign 0.03
R1107:Dlg1 UTSW 16 31846916 missense probably benign 0.00
R1349:Dlg1 UTSW 16 31812820 missense probably damaging 1.00
R1372:Dlg1 UTSW 16 31812820 missense probably damaging 1.00
R1468:Dlg1 UTSW 16 31842822 splice site probably null
R1468:Dlg1 UTSW 16 31842822 splice site probably null
R1696:Dlg1 UTSW 16 31781798 missense probably damaging 0.96
R1772:Dlg1 UTSW 16 31665667 missense possibly damaging 0.75
R1795:Dlg1 UTSW 16 31743147 missense probably benign 0.03
R2106:Dlg1 UTSW 16 31812756 missense probably damaging 1.00
R2206:Dlg1 UTSW 16 31853846 missense probably benign 0.18
R2207:Dlg1 UTSW 16 31853846 missense probably benign 0.18
R2846:Dlg1 UTSW 16 31863197 missense probably damaging 1.00
R3954:Dlg1 UTSW 16 31858008 missense probably damaging 1.00
R4714:Dlg1 UTSW 16 31790261 missense probably damaging 1.00
R4758:Dlg1 UTSW 16 31791752 missense possibly damaging 0.92
R4898:Dlg1 UTSW 16 31857946 missense probably damaging 1.00
R4964:Dlg1 UTSW 16 31754808 missense probably benign 0.21
R4966:Dlg1 UTSW 16 31754808 missense probably benign 0.21
R4985:Dlg1 UTSW 16 31788135 splice site probably null
R5068:Dlg1 UTSW 16 31684295 critical splice donor site probably null
R5069:Dlg1 UTSW 16 31684295 critical splice donor site probably null
R5078:Dlg1 UTSW 16 31856469 nonsense probably null
R5090:Dlg1 UTSW 16 31838084 missense probably damaging 1.00
R5225:Dlg1 UTSW 16 31836267 missense probably benign 0.21
R5888:Dlg1 UTSW 16 31791886 critical splice donor site probably null
R5950:Dlg1 UTSW 16 31665583 missense probably damaging 1.00
R6029:Dlg1 UTSW 16 31793570 missense probably damaging 1.00
R6132:Dlg1 UTSW 16 31836241 missense possibly damaging 0.93
R6246:Dlg1 UTSW 16 31665650 missense probably benign 0.00
R6294:Dlg1 UTSW 16 31838124 missense probably damaging 1.00
R6322:Dlg1 UTSW 16 31856479 missense probably damaging 1.00
R7147:Dlg1 UTSW 16 31791854 missense probably benign
R7216:Dlg1 UTSW 16 31796918 frame shift probably null
R7963:Dlg1 UTSW 16 31790301 missense probably null 0.92
R7985:Dlg1 UTSW 16 31788105 nonsense probably null
R8041:Dlg1 UTSW 16 31838067 missense possibly damaging 0.91
R8111:Dlg1 UTSW 16 31842802 missense possibly damaging 0.79
R8751:Dlg1 UTSW 16 31781830 missense probably benign
X0021:Dlg1 UTSW 16 31665708 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGACTGCATGCAAACTG -3'
(R):5'- TCAAGAATTCCTAGGTGCCAGAAAAG -3'

Sequencing Primer
(F):5'- ACTGCATGCAAACTGTGGTC -3'
(R):5'- GTGTACTAAATTTTCCCGGCGAAG -3'
Posted On2019-06-07