Incidental Mutation 'PIT4812001:Six2'
List |< first << previous [record 50 of 62] next >> last >|
ID556946
Institutional Source Beutler Lab
Gene Symbol Six2
Ensembl Gene ENSMUSG00000024134
Gene Namesine oculis-related homeobox 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4812001 (G1)
Quality Score167.009
Status Not validated
Chromosome17
Chromosomal Location85684277-85688274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85685301 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 258 (S258I)
Ref Sequence ENSEMBL: ENSMUSP00000024947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024947] [ENSMUST00000163568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024947
AA Change: S258I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024947
Gene: ENSMUSG00000024134
AA Change: S258I

DomainStartEndE-ValueType
HOX 125 186 8.72e-18 SMART
low complexity region 228 269 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163568
AA Change: S258I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125871
Gene: ENSMUSG00000024134
AA Change: S258I

DomainStartEndE-ValueType
Pfam:SIX1_SD 9 119 1.5e-52 PFAM
HOX 125 186 8.72e-18 SMART
low complexity region 228 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the vertebrate gene family which encode proteins homologous to the Drosophila 'sine oculis' homeobox protein. The encoded protein is a transcription factor which, like other members of this gene family, may be involved in limb or eye development. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die shortly after birth and exhibit abnormal kidney development. Abnormalities include small kidney, lack of ureteric bud branches throughout the kidney, increased apoptosis and premature and arrested nephron development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Six2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Six2 APN 17 85687891 missense probably damaging 1.00
IGL02452:Six2 APN 17 85685378 missense possibly damaging 0.91
IGL02468:Six2 APN 17 85685503 missense possibly damaging 0.80
PIT4449001:Six2 UTSW 17 85685478 missense probably benign 0.00
R2073:Six2 UTSW 17 85687505 missense probably damaging 1.00
R2075:Six2 UTSW 17 85687505 missense probably damaging 1.00
R2915:Six2 UTSW 17 85685188 missense probably damaging 1.00
R3830:Six2 UTSW 17 85685187 missense probably damaging 1.00
R5834:Six2 UTSW 17 85687664 missense probably damaging 0.96
R7555:Six2 UTSW 17 85687707 missense probably damaging 1.00
R7723:Six2 UTSW 17 85687675 missense probably benign 0.06
R8011:Six2 UTSW 17 85687672 missense probably damaging 1.00
Z1176:Six2 UTSW 17 85685456 missense probably benign 0.26
Z1177:Six2 UTSW 17 85687625 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACAGACTCCAGAATCTATCG -3'
(R):5'- AGCGAGAACTCCAATTCCAG -3'

Sequencing Primer
(F):5'- GACTCCAGAATCTATCGCCCTC -3'
(R):5'- CACAACCCGCTGGCTTC -3'
Posted On2019-06-07