Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4812001:Atrnl1'

556949

Institutional Source

Beutler Lab

Gene Symbol

Atrnl1

Ensembl Gene

ENSMUSG00000054843

Gene Name

attractin like 1

Synonyms

Alp

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

PIT4812001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57611034-58133338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57731623 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1082 (I1082V)

Ref Sequence

ENSEMBL: ENSMUSP00000076514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077282]

AlphaFold

Q6A051

Predicted Effect

probably benign
Transcript: ENSMUST00000077282
AA Change: I1082V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: I1082V

Domain	Start	End	E-Value	Type
low complexity region	25	32	N/A	INTRINSIC
EGF	61	90	5.71e-1	SMART
CUB	92	208	1.43e-11	SMART
EGF	209	244	1.95e1	SMART
Pfam:EGF_2	248	279	5.8e-7	PFAM
Pfam:Kelch_5	350	391	2.1e-9	PFAM
Pfam:Kelch_6	354	401	5.8e-8	PFAM
Pfam:Kelch_4	465	517	4.3e-7	PFAM
Pfam:Kelch_1	519	573	2.7e-6	PFAM
PSI	613	656	3.38e-1	SMART
PSI	665	708	2e-3	SMART
PSI	714	759	1.72e-2	SMART
CLECT	747	872	2.86e-20	SMART
PSI	888	938	6.26e-5	SMART
PSI	941	1011	1.73e-7	SMART
EGF_Lam	1013	1056	1.07e-5	SMART
low complexity region	1157	1173	N/A	INTRINSIC
transmembrane domain	1229	1251	N/A	INTRINSIC
low complexity region	1261	1272	N/A	INTRINSIC
low complexity region	1326	1339	N/A	INTRINSIC

Coding Region Coverage

1x: 93.8%
3x: 91.0%
10x: 85.3%
20x: 73.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	T	C	18: 6,630,053	S252P	possibly damaging	Het
4933409G03Rik	G	A	2: 68,588,948	V14I	probably benign	Het
Adgrf5	T	G	17: 43,450,369	V985G	probably damaging	Het
Ankrd44	A	T	1: 54,723,038	Y542*	probably null	Het
Atp13a3	T	C	16: 30,362,578	T75A	probably damaging	Het
Atr	T	C	9: 95,910,649	F1675L	probably benign	Het
C87977	A	G	4: 144,209,516	I56T	probably benign	Het
Clip1	T	A	5: 123,630,675	R620S	probably benign	Het
Cped1	T	C	6: 22,122,294	F391S	probably benign	Het
Cracr2a	T	C	6: 127,625,870	L230P	probably damaging	Het
Dctn1	T	A	6: 83,199,762	V1266E	possibly damaging	Het
Dlg1	T	A	16: 31,846,885	F687I	probably benign	Het
Dnah8	C	A	17: 30,708,445	D1358E	probably benign	Het
Dnajc11	A	G	4: 151,952,889	R84G	probably benign	Het
Dnajc14	C	A	10: 128,806,683	T158N	probably damaging	Het
Dscc1	A	G	15: 55,082,261	L346P	probably damaging	Het
Efcab3	A	G	11: 105,099,979	I71V	probably null	Het
Erbb3	T	A	10: 128,574,379	Q670L	possibly damaging	Het
Ercc4	G	A	16: 13,144,447	E652K	probably benign	Het
Ercc6l2	T	A	13: 63,858,257	V591D	possibly damaging	Het
Fam126b	T	G	1: 58,548,703	D117A	possibly damaging	Het
Fam3c	C	T	6: 22,321,370	G134E	probably damaging	Het
Frmd5	A	G	2: 121,586,446	V70A	probably benign	Het
Gjc1	A	T	11: 102,800,981	Y65*	probably null	Het
Gm3033	A	C	14: 3,848,891	L137F		Het
Gria4	C	A	9: 4,427,128	A771S	probably damaging	Het
Hc	A	G	2: 35,029,452	L674P	probably benign	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Inpp5f	A	T	7: 128,692,308	Y696F	probably benign	Het
Itga11	C	A	9: 62,732,193	Q157K	probably damaging	Het
Itgb5	G	T	16: 33,919,987	C489F	probably damaging	Het
Klhl38	C	T	15: 58,322,542	G264S	probably benign	Het
Krt78	C	T	15: 101,948,069	V436M	probably damaging	Het
Mia2	A	T	12: 59,101,579	D75V	possibly damaging	Het
Mphosph6	T	A	8: 117,799,149	Q20L	probably damaging	Het
Ogfr	C	T	2: 180,595,511	P630S	possibly damaging	Het
Olfr1206	G	A	2: 88,864,970	V122M	probably benign	Het
Olfr1431	T	G	19: 12,210,253	I229S	probably damaging	Het
Olfr15	A	T	16: 3,839,530	K186*	probably null	Het
Pbx3	T	C	2: 34,224,619	E101G	probably damaging	Het
Pcca	T	A	14: 122,790,382	N587K	probably benign	Het
Pdia3	G	T	2: 121,433,530	A287S	probably damaging	Het
Pfas	T	A	11: 68,990,036	D209V		Het
Pter	A	T	2: 12,980,368	I170F	probably damaging	Het
Ptprq	A	T	10: 107,666,567	V830E	probably damaging	Het
Rab11fip5	T	C	6: 85,341,558	D783G	probably benign	Het
Rbm19	T	C	5: 120,128,250	V446A	possibly damaging	Het
Selp	A	G	1: 164,132,263	N363D	probably benign	Het
Six2	C	A	17: 85,685,301	S258I	possibly damaging	Het
Smc1b	A	G	15: 85,069,651	V1139A	possibly damaging	Het
Sp1	A	G	15: 102,408,408	T121A	possibly damaging	Het
Sucla2	A	T	14: 73,579,449	I210L	possibly damaging	Het
Trank1	T	C	9: 111,347,912	L339P	probably damaging	Het
Ttll5	T	A	12: 85,926,861	D794E	probably benign	Het
Usp32	C	T	11: 85,010,074	V1107I	probably damaging	Het
Vmn1r195	T	C	13: 22,278,863	Y168H	probably benign	Het
Vmn1r223	A	G	13: 23,249,890	N218S	probably damaging	Het
Vmn2r25	T	A	6: 123,823,488	S632C	probably damaging	Het
Vwa3a	A	T	7: 120,776,133	K390I	probably damaging	Het
Zfp442	A	T	2: 150,409,741	C80*	probably null	Het
Zic1	A	T	9: 91,364,341	I226N	probably damaging	Het

Other mutations in Atrnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Atrnl1	APN	19	57691817	missense	probably benign	0.02
IGL00707:Atrnl1	APN	19	57673265	missense	probably damaging	0.96
IGL00921:Atrnl1	APN	19	57702153	missense	probably damaging	1.00
IGL01410:Atrnl1	APN	19	58131104	missense	probably damaging	1.00
IGL01468:Atrnl1	APN	19	57699712	missense	probably benign	0.02
IGL01756:Atrnl1	APN	19	57652948	missense	probably benign
IGL01971:Atrnl1	APN	19	57753283	missense	probably damaging	1.00
IGL02019:Atrnl1	APN	19	57691763	splice site	probably benign
IGL02580:Atrnl1	APN	19	57714576	splice site	probably benign
IGL02649:Atrnl1	APN	19	57650441	splice site	probably benign
IGL02676:Atrnl1	APN	19	57691884	missense	probably damaging	1.00
IGL03276:Atrnl1	APN	19	57652927	missense	probably damaging	0.99
IGL03379:Atrnl1	APN	19	57642541	missense	probably benign	0.02
Magnetogorsk	UTSW	19	57630306	missense	probably damaging	1.00
polar	UTSW	19	57652950	missense	probably benign	0.00
R0109:Atrnl1	UTSW	19	57755517	missense	possibly damaging	0.78
R0308:Atrnl1	UTSW	19	57753288	missense	probably benign	0.04
R0394:Atrnl1	UTSW	19	57673176	missense	probably benign	0.10
R0734:Atrnl1	UTSW	19	57654861	missense	probably damaging	1.00
R0811:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R0812:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R1183:Atrnl1	UTSW	19	57650293	missense	probably damaging	0.97
R1213:Atrnl1	UTSW	19	57638462	missense	probably benign	0.25
R1344:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1418:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1707:Atrnl1	UTSW	19	57686737	missense	probably benign	0.00
R1748:Atrnl1	UTSW	19	57714702	missense	probably damaging	0.99
R2051:Atrnl1	UTSW	19	57691849	missense	probably benign	0.01
R2113:Atrnl1	UTSW	19	57755616	nonsense	probably null
R2130:Atrnl1	UTSW	19	57654994	missense	probably damaging	1.00
R3710:Atrnl1	UTSW	19	57657114	missense	probably damaging	1.00
R3916:Atrnl1	UTSW	19	57935652	missense	possibly damaging	0.82
R4524:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R4707:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4712:Atrnl1	UTSW	19	57652950	missense	probably benign	0.00
R4784:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4785:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4798:Atrnl1	UTSW	19	58042361	missense	probably benign
R5172:Atrnl1	UTSW	19	57685513	nonsense	probably null
R5226:Atrnl1	UTSW	19	57650335	missense	probably benign
R5289:Atrnl1	UTSW	19	57657082	missense	probably damaging	1.00
R5372:Atrnl1	UTSW	19	57755536	missense	probably benign
R5737:Atrnl1	UTSW	19	57777888	missense	possibly damaging	0.84
R5782:Atrnl1	UTSW	19	57753286	missense	possibly damaging	0.95
R5826:Atrnl1	UTSW	19	57630292	nonsense	probably null
R6169:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R6242:Atrnl1	UTSW	19	57642478	missense	probably benign	0.02
R6342:Atrnl1	UTSW	19	57638510	missense	probably damaging	1.00
R6372:Atrnl1	UTSW	19	57650332	missense	probably benign	0.01
R6811:Atrnl1	UTSW	19	57654961	missense	probably damaging	0.98
R6897:Atrnl1	UTSW	19	58042368	missense	probably benign	0.01
R7024:Atrnl1	UTSW	19	57638450	critical splice acceptor site	probably null
R7085:Atrnl1	UTSW	19	57691857	missense	probably damaging	1.00
R7144:Atrnl1	UTSW	19	58042352	missense	probably damaging	1.00
R7259:Atrnl1	UTSW	19	57935606	nonsense	probably null
R7289:Atrnl1	UTSW	19	57650414	missense	probably benign	0.13
R7310:Atrnl1	UTSW	19	57642424	missense	possibly damaging	0.69
R7372:Atrnl1	UTSW	19	57935646	missense	possibly damaging	0.47
R7432:Atrnl1	UTSW	19	57755524	missense	probably damaging	1.00
R7478:Atrnl1	UTSW	19	57696312	missense	possibly damaging	0.89
R7556:Atrnl1	UTSW	19	57654846	missense	probably benign
R7567:Atrnl1	UTSW	19	57699523	missense	probably damaging	0.98
R7608:Atrnl1	UTSW	19	57714687	missense	probably damaging	1.00
R7632:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R7655:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7656:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7718:Atrnl1	UTSW	19	57740183	nonsense	probably null
R7721:Atrnl1	UTSW	19	57696331	missense	probably benign	0.00
R7726:Atrnl1	UTSW	19	57702072	missense	probably damaging	1.00
R7733:Atrnl1	UTSW	19	57701988	missense	probably benign	0.00
R7774:Atrnl1	UTSW	19	57699671	missense	probably damaging	1.00
R8010:Atrnl1	UTSW	19	57682446	missense	probably benign	0.14
R8119:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R9242:Atrnl1	UTSW	19	57657228	missense	probably benign	0.07
R9265:Atrnl1	UTSW	19	57777927	missense	probably benign	0.11
R9272:Atrnl1	UTSW	19	57654988	missense	probably benign	0.00
R9480:Atrnl1	UTSW	19	57701988	missense	possibly damaging	0.61
R9526:Atrnl1	UTSW	19	57629119	missense	probably damaging	0.99
RF021:Atrnl1	UTSW	19	57642473	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTAGGTACATGATAGACAGAGGACAC -3'
(R):5'- AGCCTCTGTAACTGCCATCG -3'

Sequencing Primer
(F):5'- AGTTTTGCAAAGTCATATAGGTGAC -3'
(R):5'- GCCTCTGTAACTGCCATCGTTAAAC -3'

Posted On

2019-06-07