Incidental Mutation 'PIT4791001:Dstyk'
ID556951
Institutional Source Beutler Lab
Gene Symbol Dstyk
Ensembl Gene ENSMUSG00000042046
Gene Namedual serine/threonine and tyrosine protein kinase
SynonymsC430014H23Rik, A930019K20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #PIT4791001 (G1)
Quality Score186.009
Status Not validated
Chromosome1
Chromosomal Location132417555-132466958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132449927 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 424 (T424A)
Ref Sequence ENSEMBL: ENSMUSP00000035358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045110] [ENSMUST00000188389]
Predicted Effect probably benign
Transcript: ENSMUST00000045110
AA Change: T424A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035358
Gene: ENSMUSG00000042046
AA Change: T424A

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Pfam:Pkinase_Tyr 651 904 6.9e-37 PFAM
Pfam:Pkinase 651 905 5.1e-37 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000188389
AA Change: T424A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139652
Gene: ENSMUSG00000042046
AA Change: T424A

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
S_TKc 650 859 2e-13 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 83.3%
  • 20x: 68.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual serine/threonine and tyrosine protein kinase which is expressed in multiple tissues. It is thought to function as a regulator of cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous knockout results in impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,274,062 F326S possibly damaging Het
Ago2 G A 15: 73,121,240 T472I possibly damaging Het
Ambp T A 4: 63,154,061 probably benign Het
As3mt T A 19: 46,720,349 F261I probably damaging Het
Atxn1l A G 8: 109,731,947 L561P probably damaging Het
Cnr2 A G 4: 135,916,952 T114A probably damaging Het
Dchs1 A G 7: 105,758,971 Y1885H probably damaging Het
Dcn A G 10: 97,507,742 N188S probably benign Het
Dennd6b A C 15: 89,186,752 probably null Het
Gabrr3 A G 16: 59,429,935 probably null Het
Gnai3 A G 3: 108,118,305 S153P probably benign Het
Igkv2-112 T A 6: 68,220,615 S90R probably damaging Het
Lxn T C 3: 67,458,646 D173G probably damaging Het
Mcm3ap T A 10: 76,506,473 I1600N probably damaging Het
Myof A T 19: 37,982,958 probably null Het
Nrxn1 T C 17: 90,455,503 probably benign Het
Oaz3 A G 3: 94,433,545 Y232H unknown Het
Olfr1107 A T 2: 87,071,702 M144K possibly damaging Het
Pkdcc C T 17: 83,220,148 R252* probably null Het
Plcl1 A G 1: 55,701,931 N907S probably benign Het
Plscr1 T A 9: 92,263,097 Y53* probably null Het
Pm20d2 T C 4: 33,174,756 T377A probably benign Het
Ptchd3 T A 11: 121,832,049 V321D probably damaging Het
Ranbp3l T C 15: 9,060,748 I366T probably damaging Het
Sardh T C 2: 27,197,648 E737G probably damaging Het
Scn1a T C 2: 66,273,282 E1878G probably benign Het
Slit3 T C 11: 35,661,245 V872A possibly damaging Het
Sugp2 C T 8: 70,260,545 Q1054* probably null Het
Syne3 T C 12: 104,963,179 T261A probably benign Het
Tgif2 T C 2: 156,853,312 S126P probably benign Het
Ticrr T C 7: 79,669,638 V457A possibly damaging Het
Tm7sf2 T C 19: 6,063,605 I299V probably benign Het
Tnks1bp1 A G 2: 85,062,558 E943G probably benign Het
Tpd52l2 T A 2: 181,499,888 F21L probably benign Het
Tpm2 A G 4: 43,519,263 L176P probably benign Het
Trim34a C A 7: 104,260,484 T293K probably benign Het
Ttc23 A T 7: 67,662,387 D14V probably damaging Het
Twsg1 T C 17: 65,929,711 E108G probably benign Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Vmn1r183 A G 7: 24,054,841 Q23R probably damaging Het
Vmn1r31 A G 6: 58,472,043 V279A probably damaging Het
Vmo1 A C 11: 70,513,835 C113W probably damaging Het
Zfp984 A G 4: 147,756,146 S83P probably benign Het
Zik1 A C 7: 10,492,329 L37R probably benign Het
Other mutations in Dstyk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Dstyk APN 1 132459988 missense probably damaging 1.00
IGL01753:Dstyk APN 1 132462939 missense probably damaging 1.00
IGL02156:Dstyk APN 1 132449926 missense probably benign 0.27
IGL02175:Dstyk APN 1 132449391 nonsense probably null
IGL02721:Dstyk APN 1 132449316 missense probably benign 0.03
IGL03194:Dstyk APN 1 132456316 splice site probably benign
PIT4305001:Dstyk UTSW 1 132455896 nonsense probably null
R0135:Dstyk UTSW 1 132462934 missense probably damaging 1.00
R0309:Dstyk UTSW 1 132456864 splice site probably benign
R0399:Dstyk UTSW 1 132453080 splice site probably benign
R0781:Dstyk UTSW 1 132453325 splice site probably benign
R1110:Dstyk UTSW 1 132453325 splice site probably benign
R1138:Dstyk UTSW 1 132463486 missense probably benign 0.00
R1300:Dstyk UTSW 1 132449913 missense probably benign 0.02
R1330:Dstyk UTSW 1 132449880 missense probably benign 0.25
R1509:Dstyk UTSW 1 132456346 missense probably damaging 1.00
R1667:Dstyk UTSW 1 132456919 missense probably damaging 1.00
R1728:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1729:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1730:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1739:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1757:Dstyk UTSW 1 132434094 splice site probably benign
R1762:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1783:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1784:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1785:Dstyk UTSW 1 132456984 missense probably damaging 1.00
R1829:Dstyk UTSW 1 132449595 missense probably benign 0.06
R2031:Dstyk UTSW 1 132453191 missense probably damaging 0.99
R2124:Dstyk UTSW 1 132453119 missense possibly damaging 0.64
R2132:Dstyk UTSW 1 132449484 missense probably null
R2143:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R2144:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R2145:Dstyk UTSW 1 132463375 missense probably damaging 1.00
R3804:Dstyk UTSW 1 132449726 missense probably damaging 1.00
R4277:Dstyk UTSW 1 132455413 splice site probably null
R4504:Dstyk UTSW 1 132434389 missense possibly damaging 0.81
R4674:Dstyk UTSW 1 132463390 missense probably benign 0.42
R4697:Dstyk UTSW 1 132449487 missense probably damaging 0.98
R4828:Dstyk UTSW 1 132434137 missense probably benign
R4940:Dstyk UTSW 1 132453106 missense probably damaging 0.96
R5029:Dstyk UTSW 1 132449324 missense probably benign 0.01
R5678:Dstyk UTSW 1 132453291 missense probably benign
R5900:Dstyk UTSW 1 132456979 missense probably damaging 1.00
R5935:Dstyk UTSW 1 132454137 missense probably damaging 0.99
R5973:Dstyk UTSW 1 132434411 missense probably damaging 0.99
R6217:Dstyk UTSW 1 132459939 missense probably damaging 1.00
R6381:Dstyk UTSW 1 132456765 intron probably null
R6429:Dstyk UTSW 1 132449804 nonsense probably null
R7038:Dstyk UTSW 1 132454109 missense probably benign 0.32
R7240:Dstyk UTSW 1 132454123 missense probably benign 0.02
R7411:Dstyk UTSW 1 132417666 missense probably benign 0.01
R7714:Dstyk UTSW 1 132456876 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTACAGAACCGCCTAGTGGATG -3'
(R):5'- AGAGGCCATCTCATCTCAGTG -3'

Sequencing Primer
(F):5'- AGCCAAGGCCCTGAATGTG -3'
(R):5'- TCATCTCAGTGACTAAAGGTGCC -3'
Posted On2019-06-07