Incidental Mutation 'PIT4791001:Tnks1bp1'
ID556954
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Nametankyrase 1 binding protein 1
SynonymsTAB182
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4791001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85048022-85073048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85062558 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 943 (E943G)
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
Predicted Effect probably benign
Transcript: ENSMUST00000048400
AA Change: E281G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955
AA Change: E281G

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111605
AA Change: E943G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: E943G

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 83.3%
  • 20x: 68.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,274,062 F326S possibly damaging Het
Ago2 G A 15: 73,121,240 T472I possibly damaging Het
Ambp T A 4: 63,154,061 probably benign Het
As3mt T A 19: 46,720,349 F261I probably damaging Het
Atxn1l A G 8: 109,731,947 L561P probably damaging Het
Cnr2 A G 4: 135,916,952 T114A probably damaging Het
Dchs1 A G 7: 105,758,971 Y1885H probably damaging Het
Dcn A G 10: 97,507,742 N188S probably benign Het
Dennd6b A C 15: 89,186,752 probably null Het
Dstyk A G 1: 132,449,927 T424A probably benign Het
Gabrr3 A G 16: 59,429,935 probably null Het
Gnai3 A G 3: 108,118,305 S153P probably benign Het
Igkv2-112 T A 6: 68,220,615 S90R probably damaging Het
Lxn T C 3: 67,458,646 D173G probably damaging Het
Mcm3ap T A 10: 76,506,473 I1600N probably damaging Het
Myof A T 19: 37,982,958 probably null Het
Nrxn1 T C 17: 90,455,503 probably benign Het
Oaz3 A G 3: 94,433,545 Y232H unknown Het
Olfr1107 A T 2: 87,071,702 M144K possibly damaging Het
Pkdcc C T 17: 83,220,148 R252* probably null Het
Plcl1 A G 1: 55,701,931 N907S probably benign Het
Plscr1 T A 9: 92,263,097 Y53* probably null Het
Pm20d2 T C 4: 33,174,756 T377A probably benign Het
Ptchd3 T A 11: 121,832,049 V321D probably damaging Het
Ranbp3l T C 15: 9,060,748 I366T probably damaging Het
Sardh T C 2: 27,197,648 E737G probably damaging Het
Scn1a T C 2: 66,273,282 E1878G probably benign Het
Slit3 T C 11: 35,661,245 V872A possibly damaging Het
Sugp2 C T 8: 70,260,545 Q1054* probably null Het
Syne3 T C 12: 104,963,179 T261A probably benign Het
Tgif2 T C 2: 156,853,312 S126P probably benign Het
Ticrr T C 7: 79,669,638 V457A possibly damaging Het
Tm7sf2 T C 19: 6,063,605 I299V probably benign Het
Tpd52l2 T A 2: 181,499,888 F21L probably benign Het
Tpm2 A G 4: 43,519,263 L176P probably benign Het
Trim34a C A 7: 104,260,484 T293K probably benign Het
Ttc23 A T 7: 67,662,387 D14V probably damaging Het
Twsg1 T C 17: 65,929,711 E108G probably benign Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Vmn1r183 A G 7: 24,054,841 Q23R probably damaging Het
Vmn1r31 A G 6: 58,472,043 V279A probably damaging Het
Vmo1 A C 11: 70,513,835 C113W probably damaging Het
Zfp984 A G 4: 147,756,146 S83P probably benign Het
Zik1 A C 7: 10,492,329 L37R probably benign Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.92
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
R7535:Tnks1bp1 UTSW 2 85063280 nonsense probably null
R7596:Tnks1bp1 UTSW 2 85062713 missense probably benign 0.14
R7680:Tnks1bp1 UTSW 2 85059241 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CCGAGATGCAAGCCTTCAAG -3'
(R):5'- GGCCTCACAAAACCTGTCTTC -3'

Sequencing Primer
(F):5'- TGCAAGCCTTCAAGACTGG -3'
(R):5'- AACCTGTCTTCACCAACTGGGG -3'
Posted On2019-06-07