Incidental Mutation 'PIT4791001:Olfr1107'
ID556955
Institutional Source Beutler Lab
Gene Symbol Olfr1107
Ensembl Gene ENSMUSG00000075163
Gene Nameolfactory receptor 1107
SynonymsGA_x6K02T2Q125-48565383-48564445, MOR172-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #PIT4791001 (G1)
Quality Score194.009
Status Not validated
Chromosome2
Chromosomal Location87068671-87075817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87071702 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 144 (M144K)
Ref Sequence ENSEMBL: ENSMUSP00000150135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099865] [ENSMUST00000214049]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099865
AA Change: M144K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097450
Gene: ENSMUSG00000075163
AA Change: M144K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-53 PFAM
Pfam:7tm_1 41 290 1.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214049
AA Change: M144K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 83.3%
  • 20x: 68.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,274,062 F326S possibly damaging Het
Ago2 G A 15: 73,121,240 T472I possibly damaging Het
Ambp T A 4: 63,154,061 probably benign Het
As3mt T A 19: 46,720,349 F261I probably damaging Het
Atxn1l A G 8: 109,731,947 L561P probably damaging Het
Cnr2 A G 4: 135,916,952 T114A probably damaging Het
Dchs1 A G 7: 105,758,971 Y1885H probably damaging Het
Dcn A G 10: 97,507,742 N188S probably benign Het
Dennd6b A C 15: 89,186,752 probably null Het
Dstyk A G 1: 132,449,927 T424A probably benign Het
Gabrr3 A G 16: 59,429,935 probably null Het
Gnai3 A G 3: 108,118,305 S153P probably benign Het
Igkv2-112 T A 6: 68,220,615 S90R probably damaging Het
Lxn T C 3: 67,458,646 D173G probably damaging Het
Mcm3ap T A 10: 76,506,473 I1600N probably damaging Het
Myof A T 19: 37,982,958 probably null Het
Nrxn1 T C 17: 90,455,503 probably benign Het
Oaz3 A G 3: 94,433,545 Y232H unknown Het
Pkdcc C T 17: 83,220,148 R252* probably null Het
Plcl1 A G 1: 55,701,931 N907S probably benign Het
Plscr1 T A 9: 92,263,097 Y53* probably null Het
Pm20d2 T C 4: 33,174,756 T377A probably benign Het
Ptchd3 T A 11: 121,832,049 V321D probably damaging Het
Ranbp3l T C 15: 9,060,748 I366T probably damaging Het
Sardh T C 2: 27,197,648 E737G probably damaging Het
Scn1a T C 2: 66,273,282 E1878G probably benign Het
Slit3 T C 11: 35,661,245 V872A possibly damaging Het
Sugp2 C T 8: 70,260,545 Q1054* probably null Het
Syne3 T C 12: 104,963,179 T261A probably benign Het
Tgif2 T C 2: 156,853,312 S126P probably benign Het
Ticrr T C 7: 79,669,638 V457A possibly damaging Het
Tm7sf2 T C 19: 6,063,605 I299V probably benign Het
Tnks1bp1 A G 2: 85,062,558 E943G probably benign Het
Tpd52l2 T A 2: 181,499,888 F21L probably benign Het
Tpm2 A G 4: 43,519,263 L176P probably benign Het
Trim34a C A 7: 104,260,484 T293K probably benign Het
Ttc23 A T 7: 67,662,387 D14V probably damaging Het
Twsg1 T C 17: 65,929,711 E108G probably benign Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Vmn1r183 A G 7: 24,054,841 Q23R probably damaging Het
Vmn1r31 A G 6: 58,472,043 V279A probably damaging Het
Vmo1 A C 11: 70,513,835 C113W probably damaging Het
Zfp984 A G 4: 147,756,146 S83P probably benign Het
Zik1 A C 7: 10,492,329 L37R probably benign Het
Other mutations in Olfr1107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Olfr1107 APN 2 87071219 missense probably benign 0.00
IGL01521:Olfr1107 APN 2 87071733 missense probably benign 0.11
IGL03350:Olfr1107 APN 2 87071560 missense probably damaging 1.00
R0801:Olfr1107 UTSW 2 87072063 nonsense probably null
R1383:Olfr1107 UTSW 2 87071792 missense probably damaging 1.00
R1577:Olfr1107 UTSW 2 87071397 missense probably benign 0.15
R1762:Olfr1107 UTSW 2 87071921 missense probably damaging 1.00
R2027:Olfr1107 UTSW 2 87071553 missense possibly damaging 0.85
R3850:Olfr1107 UTSW 2 87071966 missense possibly damaging 0.89
R5345:Olfr1107 UTSW 2 87071492 missense possibly damaging 0.61
R5409:Olfr1107 UTSW 2 87071870 missense possibly damaging 0.64
R5451:Olfr1107 UTSW 2 87071997 missense probably damaging 1.00
R5735:Olfr1107 UTSW 2 87071412 missense probably damaging 1.00
R6091:Olfr1107 UTSW 2 87071361 missense probably benign 0.03
R6869:Olfr1107 UTSW 2 87071673 missense probably benign 0.11
R7080:Olfr1107 UTSW 2 87071739 missense probably damaging 1.00
R8130:Olfr1107 UTSW 2 87071226 missense probably benign 0.09
R8147:Olfr1107 UTSW 2 87071673 missense probably benign 0.11
Z1177:Olfr1107 UTSW 2 87071765 missense possibly damaging 0.72
Z1177:Olfr1107 UTSW 2 87072113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGATTCTCAGGATGGCAATG -3'
(R):5'- TTCTCTCAGAACACAAGTCTAGC -3'

Sequencing Primer
(F):5'- TCTCAGGATGGCAATGATAATATGG -3'
(R):5'- ACAAGTCTAGCACATTCTTTGGCTG -3'
Posted On2019-06-07