Incidental Mutation 'PIT4791001:Gnai3'
ID556960
Institutional Source Beutler Lab
Gene Symbol Gnai3
Ensembl Gene ENSMUSG00000000001
Gene Nameguanine nucleotide binding protein (G protein), alpha inhibiting 3
SynonymsGalphai3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4791001 (G1)
Quality Score209.009
Status Not validated
Chromosome3
Chromosomal Location108107280-108146146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108118305 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 153 (S153P)
Ref Sequence ENSEMBL: ENSMUSP00000000001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000001]
PDB Structure
Crystal structure of p115RhoGEF RGS domain in complex with G alpha 13 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000000001
AA Change: S153P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000001
Gene: ENSMUSG00000000001
AA Change: S153P

DomainStartEndE-ValueType
G_alpha 13 353 4.43e-218 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 83.3%
  • 20x: 68.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling pathways. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes an alpha subunit and belongs to the G-alpha family. Mutation in this gene, resulting in a gly40-to-arg substitution, is associated with auriculocondylar syndrome, and shown to affect downstream targets in the G protein-coupled endothelin receptor pathway. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal basal cardiac function and beta-adrenergic sensitivity. Mice homozygous for a different knock-out allele exhibit enhanced T cell migration toward CXCR3 agonists. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,274,062 F326S possibly damaging Het
Ago2 G A 15: 73,121,240 T472I possibly damaging Het
Ambp T A 4: 63,154,061 probably benign Het
As3mt T A 19: 46,720,349 F261I probably damaging Het
Atxn1l A G 8: 109,731,947 L561P probably damaging Het
Cnr2 A G 4: 135,916,952 T114A probably damaging Het
Dchs1 A G 7: 105,758,971 Y1885H probably damaging Het
Dcn A G 10: 97,507,742 N188S probably benign Het
Dennd6b A C 15: 89,186,752 probably null Het
Dstyk A G 1: 132,449,927 T424A probably benign Het
Gabrr3 A G 16: 59,429,935 probably null Het
Igkv2-112 T A 6: 68,220,615 S90R probably damaging Het
Lxn T C 3: 67,458,646 D173G probably damaging Het
Mcm3ap T A 10: 76,506,473 I1600N probably damaging Het
Myof A T 19: 37,982,958 probably null Het
Nrxn1 T C 17: 90,455,503 probably benign Het
Oaz3 A G 3: 94,433,545 Y232H unknown Het
Olfr1107 A T 2: 87,071,702 M144K possibly damaging Het
Pkdcc C T 17: 83,220,148 R252* probably null Het
Plcl1 A G 1: 55,701,931 N907S probably benign Het
Plscr1 T A 9: 92,263,097 Y53* probably null Het
Pm20d2 T C 4: 33,174,756 T377A probably benign Het
Ptchd3 T A 11: 121,832,049 V321D probably damaging Het
Ranbp3l T C 15: 9,060,748 I366T probably damaging Het
Sardh T C 2: 27,197,648 E737G probably damaging Het
Scn1a T C 2: 66,273,282 E1878G probably benign Het
Slit3 T C 11: 35,661,245 V872A possibly damaging Het
Sugp2 C T 8: 70,260,545 Q1054* probably null Het
Syne3 T C 12: 104,963,179 T261A probably benign Het
Tgif2 T C 2: 156,853,312 S126P probably benign Het
Ticrr T C 7: 79,669,638 V457A possibly damaging Het
Tm7sf2 T C 19: 6,063,605 I299V probably benign Het
Tnks1bp1 A G 2: 85,062,558 E943G probably benign Het
Tpd52l2 T A 2: 181,499,888 F21L probably benign Het
Tpm2 A G 4: 43,519,263 L176P probably benign Het
Trim34a C A 7: 104,260,484 T293K probably benign Het
Ttc23 A T 7: 67,662,387 D14V probably damaging Het
Twsg1 T C 17: 65,929,711 E108G probably benign Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Vmn1r183 A G 7: 24,054,841 Q23R probably damaging Het
Vmn1r31 A G 6: 58,472,043 V279A probably damaging Het
Vmo1 A C 11: 70,513,835 C113W probably damaging Het
Zfp984 A G 4: 147,756,146 S83P probably benign Het
Zik1 A C 7: 10,492,329 L37R probably benign Het
Other mutations in Gnai3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Gnai3 APN 3 108115757 splice site probably benign
IGL01672:Gnai3 APN 3 108109459 missense probably damaging 1.00
IGL02708:Gnai3 APN 3 108118344 missense probably benign
IGL03067:Gnai3 APN 3 108118293 splice site probably benign
R0388:Gnai3 UTSW 3 108115757 splice site probably benign
R0554:Gnai3 UTSW 3 108123612 missense probably benign 0.01
R1696:Gnai3 UTSW 3 108109459 missense probably damaging 1.00
R1835:Gnai3 UTSW 3 108118407 missense probably benign
R2057:Gnai3 UTSW 3 108112496 missense probably benign
R3744:Gnai3 UTSW 3 108109398 splice site probably benign
R5268:Gnai3 UTSW 3 108123541 critical splice donor site probably null
R6644:Gnai3 UTSW 3 108123536 splice site probably null
R7527:Gnai3 UTSW 3 108118377 missense
R7544:Gnai3 UTSW 3 108118386 missense
Predicted Primers PCR Primer
(F):5'- CAATGAACATTCTCTAGAGTCACC -3'
(R):5'- AGTGGGAATTCATCTGCCCC -3'

Sequencing Primer
(F):5'- GCAGGGTTTCTCTGTATAGTCC -3'
(R):5'- GGAATTCATCTGCCCCTGTCTTAAC -3'
Posted On2019-06-07