Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4791001:Ticrr'

556971

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

PIT4791001 (G1)

Quality Score

139.008

Status

Not validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79669638 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 457 (V457A)

Ref Sequence

ENSEMBL: ENSMUSP00000041377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035977
AA Change: V457A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: V457A

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206017

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206591
AA Change: V457A

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206622
AA Change: V457A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 93.5%
3x: 90.8%
10x: 83.3%
20x: 68.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	T	C	7: 140,274,062	F326S	possibly damaging	Het
Ago2	G	A	15: 73,121,240	T472I	possibly damaging	Het
Ambp	T	A	4: 63,154,061		probably benign	Het
As3mt	T	A	19: 46,720,349	F261I	probably damaging	Het
Atxn1l	A	G	8: 109,731,947	L561P	probably damaging	Het
Cnr2	A	G	4: 135,916,952	T114A	probably damaging	Het
Dchs1	A	G	7: 105,758,971	Y1885H	probably damaging	Het
Dcn	A	G	10: 97,507,742	N188S	probably benign	Het
Dennd6b	A	C	15: 89,186,752		probably null	Het
Dstyk	A	G	1: 132,449,927	T424A	probably benign	Het
Gabrr3	A	G	16: 59,429,935		probably null	Het
Gnai3	A	G	3: 108,118,305	S153P	probably benign	Het
Igkv2-112	T	A	6: 68,220,615	S90R	probably damaging	Het
Lxn	T	C	3: 67,458,646	D173G	probably damaging	Het
Mcm3ap	T	A	10: 76,506,473	I1600N	probably damaging	Het
Myof	A	T	19: 37,982,958		probably null	Het
Nrxn1	T	C	17: 90,455,503		probably benign	Het
Oaz3	A	G	3: 94,433,545	Y232H	unknown	Het
Olfr1107	A	T	2: 87,071,702	M144K	possibly damaging	Het
Pkdcc	C	T	17: 83,220,148	R252*	probably null	Het
Plcl1	A	G	1: 55,701,931	N907S	probably benign	Het
Plscr1	T	A	9: 92,263,097	Y53*	probably null	Het
Pm20d2	T	C	4: 33,174,756	T377A	probably benign	Het
Ptchd3	T	A	11: 121,832,049	V321D	probably damaging	Het
Ranbp3l	T	C	15: 9,060,748	I366T	probably damaging	Het
Sardh	T	C	2: 27,197,648	E737G	probably damaging	Het
Scn1a	T	C	2: 66,273,282	E1878G	probably benign	Het
Slit3	T	C	11: 35,661,245	V872A	possibly damaging	Het
Sugp2	C	T	8: 70,260,545	Q1054*	probably null	Het
Syne3	T	C	12: 104,963,179	T261A	probably benign	Het
Tgif2	T	C	2: 156,853,312	S126P	probably benign	Het
Tm7sf2	T	C	19: 6,063,605	I299V	probably benign	Het
Tnks1bp1	A	G	2: 85,062,558	E943G	probably benign	Het
Tpd52l2	T	A	2: 181,499,888	F21L	probably benign	Het
Tpm2	A	G	4: 43,519,263	L176P	probably benign	Het
Trim34a	C	A	7: 104,260,484	T293K	probably benign	Het
Ttc23	A	T	7: 67,662,387	D14V	probably damaging	Het
Twsg1	T	C	17: 65,929,711	E108G	probably benign	Het
Txndc15	C	T	13: 55,721,694	A220V	probably benign	Het
Vmn1r183	A	G	7: 24,054,841	Q23R	probably damaging	Het
Vmn1r31	A	G	6: 58,472,043	V279A	probably damaging	Het
Vmo1	A	C	11: 70,513,835	C113W	probably damaging	Het
Zfp984	A	G	4: 147,756,146	S83P	probably benign	Het
Zik1	A	C	7: 10,492,329	L37R	probably benign	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4305001:Ticrr	UTSW	7	79679023	missense	possibly damaging	0.95
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0362:Ticrr	UTSW	7	79677340	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1658:Ticrr	UTSW	7	79695549	missense	possibly damaging	0.57
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R2178:Ticrr	UTSW	7	79665685	missense	probably benign	0.12
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5568:Ticrr	UTSW	7	79695296	nonsense	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5879:Ticrr	UTSW	7	79696690	missense	probably benign	0.12
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6277:Ticrr	UTSW	7	79694696	missense	probably benign	0.00
R6335:Ticrr	UTSW	7	79694283	unclassified	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7285:Ticrr	UTSW	7	79660862	missense	possibly damaging	0.93
R7385:Ticrr	UTSW	7	79691849	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CAGTGTGGATCCTGGTGAAG -3'
(R):5'- CTTTAGCTGGAGACCTTCAGG -3'

Sequencing Primer
(F):5'- ATCCTGGTGAAGGCTGGC -3'
(R):5'- AACGGCCGATAGCTTCTATAG -3'

Posted On

2019-06-07