Incidental Mutation 'R0585:Npbwr1'
ID55698
Institutional Source Beutler Lab
Gene Symbol Npbwr1
Ensembl Gene ENSMUSG00000033774
Gene Nameneuropeptides B/W receptor 1
SynonymsGpr7
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0585 (G1)
Quality Score132
Status Validated
Chromosome1
Chromosomal Location5913707-5917398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5916458 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 279 (T279I)
Ref Sequence ENSEMBL: ENSMUSP00000046233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044180]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044180
AA Change: T279I

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046233
Gene: ENSMUSG00000033774
AA Change: T279I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 44 327 1.3e-7 PFAM
Pfam:7TM_GPCR_Srsx 50 324 8.5e-10 PFAM
Pfam:7tm_1 56 309 1e-48 PFAM
Meta Mutation Damage Score 0.0986 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Homozygous null males develop adult-onset obesity, are hyperphagic, and have decreased energy expenditure and locomotor activity. Plasma levels of glucose, leptin and insulin are elevated in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Npbwr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Npbwr1 APN 1 5916965 missense possibly damaging 0.55
R0140:Npbwr1 UTSW 1 5916621 missense probably damaging 1.00
R0827:Npbwr1 UTSW 1 5916789 missense possibly damaging 0.85
R1472:Npbwr1 UTSW 1 5916681 missense probably damaging 1.00
R1646:Npbwr1 UTSW 1 5917254 missense probably benign 0.01
R2001:Npbwr1 UTSW 1 5917175 missense possibly damaging 0.81
R2004:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2005:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2006:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2259:Npbwr1 UTSW 1 5916658 missense probably damaging 1.00
R4172:Npbwr1 UTSW 1 5916936 missense probably damaging 1.00
R5614:Npbwr1 UTSW 1 5916811 missense probably damaging 1.00
R6379:Npbwr1 UTSW 1 5917219 missense probably benign 0.03
R7022:Npbwr1 UTSW 1 5917100 missense probably damaging 1.00
R7462:Npbwr1 UTSW 1 5916932 missense probably damaging 1.00
R7678:Npbwr1 UTSW 1 5916708 missense probably benign 0.03
R8441:Npbwr1 UTSW 1 5917178 missense possibly damaging 0.73
R8547:Npbwr1 UTSW 1 5917227 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATCAGGCTGAACGGCATGACAC -3'
(R):5'- TGTGCAAGCTCATTGTAGCCGTC -3'

Sequencing Primer
(F):5'- TGACACCAATTGCCGGAG -3'
(R):5'- GACCGATACCTGGTGGTTC -3'
Posted On2013-07-11