Incidental Mutation 'PIT4791001:Vmo1'
ID556981
Institutional Source Beutler Lab
Gene Symbol Vmo1
Ensembl Gene ENSMUSG00000020830
Gene Namevitelline membrane outer layer 1 homolog (chicken)
SynonymsLOC327956
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #PIT4791001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70513516-70514616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70513835 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 113 (C113W)
Ref Sequence ENSEMBL: ENSMUSP00000021179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019063] [ENSMUST00000021179]
Predicted Effect probably benign
Transcript: ENSMUST00000019063
SMART Domains Protein: ENSMUSP00000019063
Gene: ENSMUSG00000018919

DomainStartEndE-ValueType
Pfam:L6_membrane 1 189 3.8e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021179
AA Change: C113W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021179
Gene: ENSMUSG00000020830
AA Change: C113W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:VOMI 35 199 6.2e-64 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 83.3%
  • 20x: 68.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,274,062 F326S possibly damaging Het
Ago2 G A 15: 73,121,240 T472I possibly damaging Het
Ambp T A 4: 63,154,061 probably benign Het
As3mt T A 19: 46,720,349 F261I probably damaging Het
Atxn1l A G 8: 109,731,947 L561P probably damaging Het
Cnr2 A G 4: 135,916,952 T114A probably damaging Het
Dchs1 A G 7: 105,758,971 Y1885H probably damaging Het
Dcn A G 10: 97,507,742 N188S probably benign Het
Dennd6b A C 15: 89,186,752 probably null Het
Dstyk A G 1: 132,449,927 T424A probably benign Het
Gabrr3 A G 16: 59,429,935 probably null Het
Gnai3 A G 3: 108,118,305 S153P probably benign Het
Igkv2-112 T A 6: 68,220,615 S90R probably damaging Het
Lxn T C 3: 67,458,646 D173G probably damaging Het
Mcm3ap T A 10: 76,506,473 I1600N probably damaging Het
Myof A T 19: 37,982,958 probably null Het
Nrxn1 T C 17: 90,455,503 probably benign Het
Oaz3 A G 3: 94,433,545 Y232H unknown Het
Olfr1107 A T 2: 87,071,702 M144K possibly damaging Het
Pkdcc C T 17: 83,220,148 R252* probably null Het
Plcl1 A G 1: 55,701,931 N907S probably benign Het
Plscr1 T A 9: 92,263,097 Y53* probably null Het
Pm20d2 T C 4: 33,174,756 T377A probably benign Het
Ptchd3 T A 11: 121,832,049 V321D probably damaging Het
Ranbp3l T C 15: 9,060,748 I366T probably damaging Het
Sardh T C 2: 27,197,648 E737G probably damaging Het
Scn1a T C 2: 66,273,282 E1878G probably benign Het
Slit3 T C 11: 35,661,245 V872A possibly damaging Het
Sugp2 C T 8: 70,260,545 Q1054* probably null Het
Syne3 T C 12: 104,963,179 T261A probably benign Het
Tgif2 T C 2: 156,853,312 S126P probably benign Het
Ticrr T C 7: 79,669,638 V457A possibly damaging Het
Tm7sf2 T C 19: 6,063,605 I299V probably benign Het
Tnks1bp1 A G 2: 85,062,558 E943G probably benign Het
Tpd52l2 T A 2: 181,499,888 F21L probably benign Het
Tpm2 A G 4: 43,519,263 L176P probably benign Het
Trim34a C A 7: 104,260,484 T293K probably benign Het
Ttc23 A T 7: 67,662,387 D14V probably damaging Het
Twsg1 T C 17: 65,929,711 E108G probably benign Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Vmn1r183 A G 7: 24,054,841 Q23R probably damaging Het
Vmn1r31 A G 6: 58,472,043 V279A probably damaging Het
Zfp984 A G 4: 147,756,146 S83P probably benign Het
Zik1 A C 7: 10,492,329 L37R probably benign Het
Other mutations in Vmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmo1 APN 11 70513598 missense probably damaging 1.00
IGL03255:Vmo1 APN 11 70514410 critical splice donor site probably null
H8441:Vmo1 UTSW 11 70513746 missense probably damaging 1.00
R2159:Vmo1 UTSW 11 70513782 missense probably benign 0.03
R5913:Vmo1 UTSW 11 70514415 missense probably damaging 0.98
R7139:Vmo1 UTSW 11 70513848 missense probably benign 0.03
R8200:Vmo1 UTSW 11 70514499 missense possibly damaging 0.74
V1024:Vmo1 UTSW 11 70513746 missense probably damaging 1.00
Z1088:Vmo1 UTSW 11 70513817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCACAGACACCTTTGGG -3'
(R):5'- GTGCCCTTCCCTGAGATAAAC -3'

Sequencing Primer
(F):5'- CAGACACCTTTGGGACATGAGTTG -3'
(R):5'- ACTCCACTAAGGTTATAGAGGTGTG -3'
Posted On2019-06-07