Incidental Mutation 'PIT4791001:Pkdcc'
ID556990
Institutional Source Beutler Lab
Gene Symbol Pkdcc
Ensembl Gene ENSMUSG00000024247
Gene Nameprotein kinase domain containing, cytoplasmic
SynonymsMAd1, Vlk, Adtk1, ESTM17
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4791001 (G1)
Quality Score98.0078
Status Not validated
Chromosome17
Chromosomal Location83215292-83225070 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 83220148 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 252 (R252*)
Ref Sequence ENSEMBL: ENSMUSP00000129238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170794]
Predicted Effect probably null
Transcript: ENSMUST00000170758
AA Change: R16*
Predicted Effect probably null
Transcript: ENSMUST00000170794
AA Change: R252*
SMART Domains Protein: ENSMUSP00000129238
Gene: ENSMUSG00000024247
AA Change: R252*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 92 128 N/A INTRINSIC
Pfam:Pkinase 139 321 1.3e-5 PFAM
Pfam:PIP49_C 196 373 3.8e-11 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 83.3%
  • 20x: 68.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants die on postnatal day P0, apparently due to ineffective respiration. They exhibit shortening of all the long bones of the fore- and hindlimbs, cleft palate, sternal dysraphia and deficient mineralization or other anomalies of multiple bones throughout the body. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,274,062 F326S possibly damaging Het
Ago2 G A 15: 73,121,240 T472I possibly damaging Het
Ambp T A 4: 63,154,061 probably benign Het
As3mt T A 19: 46,720,349 F261I probably damaging Het
Atxn1l A G 8: 109,731,947 L561P probably damaging Het
Cnr2 A G 4: 135,916,952 T114A probably damaging Het
Dchs1 A G 7: 105,758,971 Y1885H probably damaging Het
Dcn A G 10: 97,507,742 N188S probably benign Het
Dennd6b A C 15: 89,186,752 probably null Het
Dstyk A G 1: 132,449,927 T424A probably benign Het
Gabrr3 A G 16: 59,429,935 probably null Het
Gnai3 A G 3: 108,118,305 S153P probably benign Het
Igkv2-112 T A 6: 68,220,615 S90R probably damaging Het
Lxn T C 3: 67,458,646 D173G probably damaging Het
Mcm3ap T A 10: 76,506,473 I1600N probably damaging Het
Myof A T 19: 37,982,958 probably null Het
Nrxn1 T C 17: 90,455,503 probably benign Het
Oaz3 A G 3: 94,433,545 Y232H unknown Het
Olfr1107 A T 2: 87,071,702 M144K possibly damaging Het
Plcl1 A G 1: 55,701,931 N907S probably benign Het
Plscr1 T A 9: 92,263,097 Y53* probably null Het
Pm20d2 T C 4: 33,174,756 T377A probably benign Het
Ptchd3 T A 11: 121,832,049 V321D probably damaging Het
Ranbp3l T C 15: 9,060,748 I366T probably damaging Het
Sardh T C 2: 27,197,648 E737G probably damaging Het
Scn1a T C 2: 66,273,282 E1878G probably benign Het
Slit3 T C 11: 35,661,245 V872A possibly damaging Het
Sugp2 C T 8: 70,260,545 Q1054* probably null Het
Syne3 T C 12: 104,963,179 T261A probably benign Het
Tgif2 T C 2: 156,853,312 S126P probably benign Het
Ticrr T C 7: 79,669,638 V457A possibly damaging Het
Tm7sf2 T C 19: 6,063,605 I299V probably benign Het
Tnks1bp1 A G 2: 85,062,558 E943G probably benign Het
Tpd52l2 T A 2: 181,499,888 F21L probably benign Het
Tpm2 A G 4: 43,519,263 L176P probably benign Het
Trim34a C A 7: 104,260,484 T293K probably benign Het
Ttc23 A T 7: 67,662,387 D14V probably damaging Het
Twsg1 T C 17: 65,929,711 E108G probably benign Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Vmn1r183 A G 7: 24,054,841 Q23R probably damaging Het
Vmn1r31 A G 6: 58,472,043 V279A probably damaging Het
Vmo1 A C 11: 70,513,835 C113W probably damaging Het
Zfp984 A G 4: 147,756,146 S83P probably benign Het
Zik1 A C 7: 10,492,329 L37R probably benign Het
Other mutations in Pkdcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Pkdcc APN 17 83220119 missense probably damaging 1.00
IGL02517:Pkdcc APN 17 83223866 missense probably damaging 1.00
R0180:Pkdcc UTSW 17 83221870 critical splice donor site probably null
R0321:Pkdcc UTSW 17 83222112 splice site probably benign
R0559:Pkdcc UTSW 17 83216025 missense probably benign 0.00
R0799:Pkdcc UTSW 17 83223918 missense probably damaging 1.00
R1512:Pkdcc UTSW 17 83220044 missense possibly damaging 0.88
R2484:Pkdcc UTSW 17 83222238 splice site probably benign
R2916:Pkdcc UTSW 17 83215949 missense probably benign 0.00
R2918:Pkdcc UTSW 17 83215949 missense probably benign 0.00
R3120:Pkdcc UTSW 17 83220037 missense probably damaging 1.00
R3794:Pkdcc UTSW 17 83223953 missense probably damaging 0.97
R3795:Pkdcc UTSW 17 83223953 missense probably damaging 0.97
R4433:Pkdcc UTSW 17 83221141 missense probably benign 0.02
R4689:Pkdcc UTSW 17 83215861 missense probably damaging 1.00
R5239:Pkdcc UTSW 17 83215984 missense probably damaging 1.00
R5580:Pkdcc UTSW 17 83220082 missense probably damaging 0.96
R5654:Pkdcc UTSW 17 83215908 missense probably damaging 1.00
R5739:Pkdcc UTSW 17 83215794 missense probably benign 0.44
R6456:Pkdcc UTSW 17 83220119 missense probably damaging 1.00
R7046:Pkdcc UTSW 17 83224258 missense probably damaging 0.97
R7050:Pkdcc UTSW 17 83215644 missense possibly damaging 0.46
Z1088:Pkdcc UTSW 17 83222150 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTGTCACCATGCCAGTAG -3'
(R):5'- GAACACAAAAGGCCTGGCTC -3'

Sequencing Primer
(F):5'- GTGTCACCATGCCAGTAGAAACTAAG -3'
(R):5'- TTCTAAGGGAGAACCATCCC -3'
Posted On2019-06-07