Incidental Mutation 'PIT4791001:Myof'
ID556993
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Namemyoferlin
SynonymsFer1l3, E030042N20Rik, 2310051D19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4791001 (G1)
Quality Score166.009
Status Not validated
Chromosome19
Chromosomal Location37899036-38043577 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 37982958 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000226068]
Predicted Effect probably null
Transcript: ENSMUST00000041475
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172095
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000226068
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 83.3%
  • 20x: 68.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,274,062 F326S possibly damaging Het
Ago2 G A 15: 73,121,240 T472I possibly damaging Het
Ambp T A 4: 63,154,061 probably benign Het
As3mt T A 19: 46,720,349 F261I probably damaging Het
Atxn1l A G 8: 109,731,947 L561P probably damaging Het
Cnr2 A G 4: 135,916,952 T114A probably damaging Het
Dchs1 A G 7: 105,758,971 Y1885H probably damaging Het
Dcn A G 10: 97,507,742 N188S probably benign Het
Dennd6b A C 15: 89,186,752 probably null Het
Dstyk A G 1: 132,449,927 T424A probably benign Het
Gabrr3 A G 16: 59,429,935 probably null Het
Gnai3 A G 3: 108,118,305 S153P probably benign Het
Igkv2-112 T A 6: 68,220,615 S90R probably damaging Het
Lxn T C 3: 67,458,646 D173G probably damaging Het
Mcm3ap T A 10: 76,506,473 I1600N probably damaging Het
Nrxn1 T C 17: 90,455,503 probably benign Het
Oaz3 A G 3: 94,433,545 Y232H unknown Het
Olfr1107 A T 2: 87,071,702 M144K possibly damaging Het
Pkdcc C T 17: 83,220,148 R252* probably null Het
Plcl1 A G 1: 55,701,931 N907S probably benign Het
Plscr1 T A 9: 92,263,097 Y53* probably null Het
Pm20d2 T C 4: 33,174,756 T377A probably benign Het
Ptchd3 T A 11: 121,832,049 V321D probably damaging Het
Ranbp3l T C 15: 9,060,748 I366T probably damaging Het
Sardh T C 2: 27,197,648 E737G probably damaging Het
Scn1a T C 2: 66,273,282 E1878G probably benign Het
Slit3 T C 11: 35,661,245 V872A possibly damaging Het
Sugp2 C T 8: 70,260,545 Q1054* probably null Het
Syne3 T C 12: 104,963,179 T261A probably benign Het
Tgif2 T C 2: 156,853,312 S126P probably benign Het
Ticrr T C 7: 79,669,638 V457A possibly damaging Het
Tm7sf2 T C 19: 6,063,605 I299V probably benign Het
Tnks1bp1 A G 2: 85,062,558 E943G probably benign Het
Tpd52l2 T A 2: 181,499,888 F21L probably benign Het
Tpm2 A G 4: 43,519,263 L176P probably benign Het
Trim34a C A 7: 104,260,484 T293K probably benign Het
Ttc23 A T 7: 67,662,387 D14V probably damaging Het
Twsg1 T C 17: 65,929,711 E108G probably benign Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Vmn1r183 A G 7: 24,054,841 Q23R probably damaging Het
Vmn1r31 A G 6: 58,472,043 V279A probably damaging Het
Vmo1 A C 11: 70,513,835 C113W probably damaging Het
Zfp984 A G 4: 147,756,146 S83P probably benign Het
Zik1 A C 7: 10,492,329 L37R probably benign Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
R7328:Myof UTSW 19 37916399 missense probably damaging 1.00
R7485:Myof UTSW 19 37951491 nonsense probably null
R7554:Myof UTSW 19 37954510 missense probably benign 0.09
R7759:Myof UTSW 19 37939898 missense probably benign 0.00
R7779:Myof UTSW 19 37939390 missense probably damaging 1.00
R8116:Myof UTSW 19 37932719 missense probably damaging 0.99
R8264:Myof UTSW 19 37921433 missense probably damaging 1.00
R8415:Myof UTSW 19 37995424 missense probably benign
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTCATTGACACACCAAGGCC -3'
(R):5'- TGCACATCACACCCTCTGAG -3'

Sequencing Primer
(F):5'- AAGGCCCCATGCTTTGG -3'
(R):5'- ACACCCTCTGAGCTCATGGATG -3'
Posted On2019-06-07