Incidental Mutation 'PIT4151001:Pkn3'
ID556998
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Nameprotein kinase N3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4151001 (G1)
Quality Score104.008
Status Not validated
Chromosome2
Chromosomal Location30077684-30091022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30090527 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 810 (T810N)
Ref Sequence ENSEMBL: ENSMUSP00000041025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000081838] [ENSMUST00000102865]
Predicted Effect probably damaging
Transcript: ENSMUST00000045246
AA Change: T810N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785
AA Change: T810N

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081838
SMART Domains Protein: ENSMUSP00000080521
Gene: ENSMUSG00000015335

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Pfam:zf-DHHC 106 232 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102865
SMART Domains Protein: ENSMUSP00000099929
Gene: ENSMUSG00000015335

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:zf-DHHC 58 218 1.1e-38 PFAM
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 30081104 missense probably damaging 0.97
IGL00781:Pkn3 APN 2 30083390 unclassified probably benign
IGL00815:Pkn3 APN 2 30081200 missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 30087042 missense probably damaging 1.00
IGL01897:Pkn3 APN 2 30082812 unclassified probably benign
IGL02513:Pkn3 APN 2 30083137 missense probably damaging 0.98
IGL02552:Pkn3 APN 2 30080867 missense probably damaging 1.00
IGL02622:Pkn3 APN 2 30083146 missense probably benign 0.28
IGL02689:Pkn3 APN 2 30080846 missense probably damaging 1.00
IGL02996:Pkn3 APN 2 30080615 missense probably benign 0.39
IGL03106:Pkn3 APN 2 30085245 missense probably damaging 0.96
Enflamme UTSW 2 30083037 unclassified probably benign
Wrath UTSW 2 30088584 critical splice donor site probably null
R0279:Pkn3 UTSW 2 30083297 missense probably benign 0.16
R0370:Pkn3 UTSW 2 30087172 missense probably damaging 1.00
R0491:Pkn3 UTSW 2 30089877 missense probably damaging 1.00
R0600:Pkn3 UTSW 2 30081134 missense probably benign 0.06
R1418:Pkn3 UTSW 2 30083047 missense probably damaging 1.00
R1510:Pkn3 UTSW 2 30079764 critical splice donor site probably null
R1535:Pkn3 UTSW 2 30087053 missense probably benign
R1540:Pkn3 UTSW 2 30084691 missense probably damaging 1.00
R1808:Pkn3 UTSW 2 30079651 missense probably damaging 1.00
R1884:Pkn3 UTSW 2 30082828 missense probably damaging 1.00
R1995:Pkn3 UTSW 2 30089977 missense probably damaging 1.00
R3745:Pkn3 UTSW 2 30090341 missense probably damaging 1.00
R4119:Pkn3 UTSW 2 30083037 unclassified probably benign
R4258:Pkn3 UTSW 2 30088560 missense probably damaging 0.99
R4665:Pkn3 UTSW 2 30085457 unclassified probably benign
R4772:Pkn3 UTSW 2 30084680 splice site probably null
R4808:Pkn3 UTSW 2 30090081 missense probably damaging 1.00
R5038:Pkn3 UTSW 2 30085281 critical splice donor site probably null
R5388:Pkn3 UTSW 2 30081074 missense probably damaging 0.99
R5488:Pkn3 UTSW 2 30088584 critical splice donor site probably null
R5611:Pkn3 UTSW 2 30079661 missense probably damaging 1.00
R6001:Pkn3 UTSW 2 30088584 critical splice donor site probably null
R6277:Pkn3 UTSW 2 30082945 missense possibly damaging 0.93
R6562:Pkn3 UTSW 2 30080687 critical splice donor site probably null
R6724:Pkn3 UTSW 2 30090550 missense possibly damaging 0.94
R7061:Pkn3 UTSW 2 30083536 intron probably null
R7128:Pkn3 UTSW 2 30083315 missense probably damaging 1.00
R7249:Pkn3 UTSW 2 30084761 missense probably benign 0.00
R7475:Pkn3 UTSW 2 30087110 missense probably benign 0.01
R7746:Pkn3 UTSW 2 30090584 missense probably benign 0.00
R7747:Pkn3 UTSW 2 30090584 missense probably benign 0.00
R7783:Pkn3 UTSW 2 30079622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAAGTCCCCAGAGAAG -3'
(R):5'- ACATGGTTACGTGGAGGCTTC -3'

Sequencing Primer
(F):5'- AGTCCCCAGAGAAGCGTCTAG -3'
(R):5'- TGAAGTGCCAGGAGACCCTC -3'
Posted On2019-06-07