Incidental Mutation 'PIT4151001:Olfr1054'
ID557002
Institutional Source Beutler Lab
Gene Symbol Olfr1054
Ensembl Gene ENSMUSG00000075190
Gene Nameolfactory receptor 1054
SynonymsGA_x6K02T2Q125-47811880-47810942, MOR188-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #PIT4151001 (G1)
Quality Score204.009
Status Not validated
Chromosome2
Chromosomal Location86332135-86335433 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86332829 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 176 (H176N)
Ref Sequence ENSEMBL: ENSMUSP00000150810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099895] [ENSMUST00000213205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099895
AA Change: H176N

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097480
Gene: ENSMUSG00000075190
AA Change: H176N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-49 PFAM
Pfam:7tm_1 41 289 5.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213205
AA Change: H176N

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Olfr1054
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Olfr1054 APN 2 86332704 nonsense probably null
IGL02266:Olfr1054 APN 2 86332979 missense probably damaging 0.98
IGL02398:Olfr1054 APN 2 86332524 nonsense probably null
IGL02535:Olfr1054 APN 2 86332675 missense probably damaging 1.00
IGL02590:Olfr1054 APN 2 86333000 missense possibly damaging 0.52
IGL02630:Olfr1054 APN 2 86332868 missense probably benign 0.39
R0520:Olfr1054 UTSW 2 86333131 missense probably damaging 1.00
R1079:Olfr1054 UTSW 2 86332841 missense probably damaging 0.96
R1887:Olfr1054 UTSW 2 86333273 missense possibly damaging 0.90
R2037:Olfr1054 UTSW 2 86332430 missense probably benign 0.03
R2120:Olfr1054 UTSW 2 86333345 missense probably benign 0.00
R2153:Olfr1054 UTSW 2 86332528 missense probably damaging 1.00
R4523:Olfr1054 UTSW 2 86333300 missense probably benign 0.12
R4836:Olfr1054 UTSW 2 86333227 missense probably benign 0.12
R6147:Olfr1054 UTSW 2 86332500 missense probably damaging 1.00
R6802:Olfr1054 UTSW 2 86333185 missense possibly damaging 0.91
R6886:Olfr1054 UTSW 2 86333064 nonsense probably null
R6894:Olfr1054 UTSW 2 86332951 missense probably damaging 1.00
R7275:Olfr1054 UTSW 2 86332792 missense possibly damaging 0.91
R7322:Olfr1054 UTSW 2 86332564 missense probably benign 0.14
R7325:Olfr1054 UTSW 2 86333000 missense possibly damaging 0.52
R7526:Olfr1054 UTSW 2 86333353 start codon destroyed probably null 1.00
R7976:Olfr1054 UTSW 2 86332720 missense probably benign 0.05
R8421:Olfr1054 UTSW 2 86332903 missense possibly damaging 0.80
R8838:Olfr1054 UTSW 2 86332973 missense possibly damaging 0.61
Z1176:Olfr1054 UTSW 2 86332706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGATTTGGGCTGCACATAC -3'
(R):5'- ATGACCGCTATGTGGCCATC -3'

Sequencing Primer
(F):5'- AGTAGACAAAGCTTTCTGCCTGC -3'
(R):5'- ACCGCTATGTGGCCATCTGTAAG -3'
Posted On2019-06-07