Incidental Mutation 'R0585:Eps8l3'
ID55701
Institutional Source Beutler Lab
Gene Symbol Eps8l3
Ensembl Gene ENSMUSG00000040600
Gene NameEPS8-like 3
Synonyms
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0585 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107877229-107892900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 107881197 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 33 (D33H)
Ref Sequence ENSEMBL: ENSMUSP00000143754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037375] [ENSMUST00000199990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037375
AA Change: D67H

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042004
Gene: ENSMUSG00000040600
AA Change: D67H

DomainStartEndE-ValueType
Pfam:PTB 28 155 3.7e-40 PFAM
low complexity region 204 214 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
SH3 460 515 5.19e-15 SMART
PDB:2E8M|A 516 582 3e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198085
Predicted Effect probably damaging
Transcript: ENSMUST00000199990
AA Change: D33H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143754
Gene: ENSMUSG00000040600
AA Change: D33H

DomainStartEndE-ValueType
Pfam:PTB 1 88 8.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200198
Meta Mutation Damage Score 0.1697 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Eps8l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Eps8l3 APN 3 107881171 missense probably damaging 0.97
IGL01694:Eps8l3 APN 3 107892308 missense probably damaging 1.00
IGL02748:Eps8l3 APN 3 107879368 intron probably benign
PIT1430001:Eps8l3 UTSW 3 107884867 missense probably damaging 1.00
R0060:Eps8l3 UTSW 3 107879541 missense probably damaging 0.98
R0060:Eps8l3 UTSW 3 107879541 missense probably damaging 0.98
R0517:Eps8l3 UTSW 3 107883460 missense probably benign
R0555:Eps8l3 UTSW 3 107892345 missense probably benign
R0646:Eps8l3 UTSW 3 107884810 missense probably damaging 1.00
R0741:Eps8l3 UTSW 3 107882825 missense probably benign
R1682:Eps8l3 UTSW 3 107891306 missense possibly damaging 0.82
R1844:Eps8l3 UTSW 3 107879586 missense possibly damaging 0.95
R1900:Eps8l3 UTSW 3 107890952 missense probably benign 0.16
R1937:Eps8l3 UTSW 3 107884392 missense probably benign 0.02
R2010:Eps8l3 UTSW 3 107879372 start codon destroyed probably null 1.00
R2973:Eps8l3 UTSW 3 107891328 missense probably damaging 1.00
R4369:Eps8l3 UTSW 3 107891014 missense possibly damaging 0.95
R4803:Eps8l3 UTSW 3 107891009 missense probably damaging 1.00
R4926:Eps8l3 UTSW 3 107890688 splice site probably benign
R5420:Eps8l3 UTSW 3 107883985 nonsense probably null
R5580:Eps8l3 UTSW 3 107881603 missense probably damaging 1.00
R5593:Eps8l3 UTSW 3 107891188 unclassified probably benign
R5699:Eps8l3 UTSW 3 107879579 missense probably benign 0.06
R5705:Eps8l3 UTSW 3 107891264 missense probably benign 0.01
R5972:Eps8l3 UTSW 3 107884447 splice site probably null
R6250:Eps8l3 UTSW 3 107890465 missense probably benign 0.01
R7097:Eps8l3 UTSW 3 107884485 intron probably null
Z1177:Eps8l3 UTSW 3 107881666 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGAAGCCTCTTCAAGAGCCCAAC -3'
(R):5'- CCTTGCCTCTACCTGGTTTGAGATG -3'

Sequencing Primer
(F):5'- GTATTGAGAAACATGGTCTTCCCC -3'
(R):5'- CTCTACCTGGTTTGAGATGTGTATTG -3'
Posted On2013-07-11