Incidental Mutation 'R0585:Rap1gds1'
ID55702
Institutional Source Beutler Lab
Gene Symbol Rap1gds1
Ensembl Gene ENSMUSG00000028149
Gene NameRAP1, GTP-GDP dissociation stimulator 1
SynonymsGDS1
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R0585 (G1)
Quality Score219
Status Validated
Chromosome3
Chromosomal Location138925902-139075201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139021872 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 59 (T59M)
Ref Sequence ENSEMBL: ENSMUSP00000143181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029796] [ENSMUST00000098574] [ENSMUST00000196106] [ENSMUST00000196280] [ENSMUST00000200396]
Predicted Effect probably benign
Transcript: ENSMUST00000029796
AA Change: T59M

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000029796
Gene: ENSMUSG00000028149
AA Change: T59M

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 119 162 7.98e-4 SMART
ARM 297 341 2.4e-7 SMART
ARM 342 382 6.3e1 SMART
ARM 430 470 6.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098574
AA Change: T59M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096173
Gene: ENSMUSG00000028149
AA Change: T59M

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 169 211 1.74e-4 SMART
ARM 346 390 2.4e-7 SMART
ARM 391 431 6.3e1 SMART
ARM 479 519 6.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196106
AA Change: T59M

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000196280
AA Change: T59M

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143181
Gene: ENSMUSG00000028149
AA Change: T59M

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 169 211 1.74e-4 SMART
ARM 346 390 2.4e-7 SMART
ARM 391 431 6.3e1 SMART
ARM 478 518 6.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199152
Predicted Effect probably benign
Transcript: ENSMUST00000200396
AA Change: T59M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000143517
Gene: ENSMUSG00000028149
AA Change: T59M

DomainStartEndE-ValueType
ARM 77 118 6.7e-9 SMART
ARM 119 162 3.9e-6 SMART
ARM 297 341 1.2e-9 SMART
ARM 342 382 3.1e-1 SMART
ARM 430 470 3.1e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The smg GDP dissociation stimulator (smgGDS) protein is a stimulatory GDP/GTP exchange protein with GTPase activity (Riess et al., 1993 [PubMed 8262526]).[supplied by OMIM, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Rap1gds1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rap1gds1 APN 3 138983827 missense possibly damaging 0.95
IGL01314:Rap1gds1 APN 3 139050561 missense probably damaging 1.00
IGL01450:Rap1gds1 APN 3 138965920 missense probably damaging 1.00
IGL02033:Rap1gds1 APN 3 138955471 splice site probably benign
IGL02658:Rap1gds1 APN 3 138957479 missense probably damaging 1.00
IGL02745:Rap1gds1 APN 3 138956241 missense probably damaging 1.00
IGL02880:Rap1gds1 APN 3 138945756 missense probably benign 0.16
PIT4305001:Rap1gds1 UTSW 3 138956300 missense probably benign 0.05
R0006:Rap1gds1 UTSW 3 138983871 splice site probably null
R0006:Rap1gds1 UTSW 3 138983871 splice site probably null
R1573:Rap1gds1 UTSW 3 138965863 splice site probably null
R1793:Rap1gds1 UTSW 3 139050553 missense possibly damaging 0.94
R1960:Rap1gds1 UTSW 3 139050556 missense probably null 0.28
R2432:Rap1gds1 UTSW 3 138956250 missense probably damaging 0.99
R2697:Rap1gds1 UTSW 3 138983721 critical splice donor site probably null
R3792:Rap1gds1 UTSW 3 138965960 missense probably damaging 1.00
R4031:Rap1gds1 UTSW 3 139050592 splice site probably benign
R4194:Rap1gds1 UTSW 3 138959090 missense probably damaging 1.00
R4530:Rap1gds1 UTSW 3 138957425 missense probably damaging 1.00
R4696:Rap1gds1 UTSW 3 138927614 missense probably damaging 1.00
R4909:Rap1gds1 UTSW 3 138983748 missense possibly damaging 0.77
R5000:Rap1gds1 UTSW 3 138956250 missense probably damaging 1.00
R5046:Rap1gds1 UTSW 3 138955420 nonsense probably null
R5152:Rap1gds1 UTSW 3 138956201 missense probably damaging 1.00
R5163:Rap1gds1 UTSW 3 138959056 missense probably damaging 0.99
R5309:Rap1gds1 UTSW 3 138958628 missense probably damaging 1.00
R5312:Rap1gds1 UTSW 3 138958628 missense probably damaging 1.00
R5782:Rap1gds1 UTSW 3 138959079 missense possibly damaging 0.65
R5825:Rap1gds1 UTSW 3 138955375 missense possibly damaging 0.93
R6547:Rap1gds1 UTSW 3 138955338 missense probably damaging 1.00
R7227:Rap1gds1 UTSW 3 138957467 missense probably damaging 1.00
R7228:Rap1gds1 UTSW 3 138957467 missense probably damaging 1.00
R7574:Rap1gds1 UTSW 3 138956215 nonsense probably null
R7711:Rap1gds1 UTSW 3 138959113 missense probably benign 0.08
R8035:Rap1gds1 UTSW 3 139015550 missense probably damaging 1.00
RF053:Rap1gds1 UTSW 3 138941657 frame shift probably null
Z1177:Rap1gds1 UTSW 3 139050539 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCTCCCCTGTGATAAGAGGAAG -3'
(R):5'- TGGAGGTAAAGGCAGCTTATTCAGC -3'

Sequencing Primer
(F):5'- TGAGGAGCTAaaataaacaaacaaac -3'
(R):5'- AGGTCCAATGTGTATGAGTGAGC -3'
Posted On2013-07-11