Incidental Mutation 'PIT4151001:Dgki'
ID557020
Institutional Source Beutler Lab
Gene Symbol Dgki
Ensembl Gene ENSMUSG00000038665
Gene Namediacylglycerol kinase, iota
SynonymsC130010K08Rik
Accession Numbers

Genbank: NM_001081206.1

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4151001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location36846022-37300184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37063981 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 298 (H298Q)
Ref Sequence ENSEMBL: ENSMUSP00000099071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042075] [ENSMUST00000090314] [ENSMUST00000101532] [ENSMUST00000138286] [ENSMUST00000150300]
Predicted Effect probably benign
Transcript: ENSMUST00000042075
AA Change: H147Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047858
Gene: ENSMUSG00000038665
AA Change: H147Q

DomainStartEndE-ValueType
C1 22 76 3.67e-1 SMART
C1 95 153 5.92e-4 SMART
DAGKc 220 344 6.73e-58 SMART
DAGKa 370 527 2.29e-92 SMART
ANK 792 822 5.53e-3 SMART
ANK 828 857 2.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090314
AA Change: H298Q

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000087788
Gene: ENSMUSG00000038665
AA Change: H298Q

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 678 2.29e-92 SMART
ANK 943 973 5.53e-3 SMART
ANK 979 1008 2.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101532
AA Change: H298Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099071
Gene: ENSMUSG00000038665
AA Change: H298Q

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 678 2.29e-92 SMART
ANK 964 994 5.53e-3 SMART
ANK 1000 1029 2.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138286
AA Change: H298Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138628
Gene: ENSMUSG00000038665
AA Change: H298Q

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 1.8e-3 SMART
C1 246 304 2.9e-6 SMART
DAGKc 371 495 3.2e-60 SMART
DAGKa 521 678 1.1e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150300
AA Change: H298Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138457
Gene: ENSMUSG00000038665
AA Change: H298Q

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 591 1.43e-6 SMART
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV diacylglycerol kinase subfamily. Diacylglycerol kinases regulate the intracellular concentration of diacylglycerol through its phosphorylation, producing phosphatidic acid. The specific role of the enzyme encoded by this gene is undetermined, however, it may play a crucial role in the production of phosphatidic acid in the retina or in recessive forms of retinal degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are grossly normal and do not develop tumors when wounded or when exposed to phorbol ester. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Gene trapped(7)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Dgki
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dgki APN 6 36862456 missense probably benign 0.00
IGL00951:Dgki APN 6 37000159 missense probably damaging 0.97
IGL01087:Dgki APN 6 37012911 missense probably damaging 1.00
IGL01396:Dgki APN 6 37000090 missense probably damaging 1.00
IGL02113:Dgki APN 6 36913625 splice site probably benign
IGL02174:Dgki APN 6 37032921 missense probably damaging 1.00
IGL02215:Dgki APN 6 37016675 missense probably damaging 1.00
IGL02353:Dgki APN 6 36847389 missense probably damaging 1.00
IGL02360:Dgki APN 6 36847389 missense probably damaging 1.00
IGL02662:Dgki APN 6 36862486 splice site probably benign
IGL02891:Dgki APN 6 36913741 missense probably benign 0.15
IGL03040:Dgki APN 6 37149664 splice site probably benign
IGL03064:Dgki APN 6 37149664 splice site probably benign
IGL03283:Dgki APN 6 36937311 splice site probably benign
IGL03349:Dgki APN 6 37097627 critical splice acceptor site probably null
H8477:Dgki UTSW 6 37029851 splice site probably benign
R0392:Dgki UTSW 6 37000178 missense probably damaging 1.00
R0630:Dgki UTSW 6 37000198 missense probably damaging 1.00
R0718:Dgki UTSW 6 37012896 missense probably damaging 1.00
R1420:Dgki UTSW 6 37050269 splice site probably null
R1546:Dgki UTSW 6 37050203 missense probably damaging 1.00
R1634:Dgki UTSW 6 36915490 missense probably benign
R1639:Dgki UTSW 6 36937364 missense probably damaging 1.00
R1738:Dgki UTSW 6 37057432 missense possibly damaging 0.93
R1750:Dgki UTSW 6 36916434 missense probably damaging 0.96
R1808:Dgki UTSW 6 37149574 missense possibly damaging 0.84
R1834:Dgki UTSW 6 37034701 splice site probably benign
R2001:Dgki UTSW 6 36865801 missense possibly damaging 0.94
R2047:Dgki UTSW 6 36913646 missense possibly damaging 0.69
R2413:Dgki UTSW 6 36847473 missense possibly damaging 0.49
R3034:Dgki UTSW 6 37087670 missense probably damaging 1.00
R4493:Dgki UTSW 6 36974861 intron probably benign
R4684:Dgki UTSW 6 37299846 unclassified probably benign
R4727:Dgki UTSW 6 37299813 unclassified probably benign
R5104:Dgki UTSW 6 37149574 missense possibly damaging 0.84
R5756:Dgki UTSW 6 36937058 intron probably benign
R6946:Dgki UTSW 6 37299636 nonsense probably null
R8357:Dgki UTSW 6 36850956 missense possibly damaging 0.94
R8363:Dgki UTSW 6 37016678 missense probably damaging 1.00
R8424:Dgki UTSW 6 36850915 missense probably benign 0.27
R8457:Dgki UTSW 6 36850956 missense possibly damaging 0.94
R8791:Dgki UTSW 6 37019940 missense probably damaging 1.00
R8883:Dgki UTSW 6 37016673 missense probably damaging 1.00
X0066:Dgki UTSW 6 37063997 missense probably damaging 1.00
Z1177:Dgki UTSW 6 36975225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATAGGACGCCAAAGACTACTG -3'
(R):5'- TCCTGGGCTGGTTAAATGC -3'

Sequencing Primer
(F):5'- TACTGAGGGAGAAGAGCAAATCTATC -3'
(R):5'- AAATGCTGATGAGATGTATGTGTTC -3'
Posted On2019-06-07