Incidental Mutation 'PIT4151001:Ret'
ID 557022
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Name ret proto-oncogene
Synonyms RET9, c-Ret, RET51
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # PIT4151001 (G1)
Quality Score 212.009
Status Not validated
Chromosome 6
Chromosomal Location 118128706-118174679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118141702 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 975 (D975G)
Ref Sequence ENSEMBL: ENSMUSP00000032201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
AlphaFold P35546
PDB Structure Crystal Structure of Dok1 PTB Domain Complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032201
AA Change: D975G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: D975G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088790
AA Change: D975G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: D975G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 121,930,670 (GRCm39) L1389P probably damaging Het
Acot10 C T 15: 20,666,684 (GRCm39) G19D probably damaging Het
Adam20 G A 8: 41,248,081 (GRCm39) V64I possibly damaging Het
Ak6 T A 13: 100,791,603 (GRCm39) D15E probably damaging Het
Atp1a2 A G 1: 172,118,288 (GRCm39) Y129H probably damaging Het
Caskin1 C T 17: 24,721,193 (GRCm39) T511I probably damaging Het
Casp9 C T 4: 141,521,259 (GRCm39) R32* probably null Het
Ccdc40 A G 11: 119,133,277 (GRCm39) E445G probably damaging Het
Cct8 T C 16: 87,284,545 (GRCm39) E273G probably damaging Het
Chd5 G A 4: 152,462,986 (GRCm39) V1380I probably damaging Het
Coro2b C T 9: 62,336,286 (GRCm39) G272D probably damaging Het
Cyp4a10 C A 4: 115,382,072 (GRCm39) H251Q probably damaging Het
Dgki A T 6: 37,040,916 (GRCm39) H298Q probably benign Het
Dnmt3b T G 2: 153,526,399 (GRCm39) probably null Het
Dzip1 A G 14: 119,160,200 (GRCm39) F3L probably damaging Het
Egf A G 3: 129,496,198 (GRCm39) S807P probably benign Het
Emc10 C T 7: 44,142,627 (GRCm39) R105H Het
Enthd1 T C 15: 80,336,937 (GRCm39) E499G probably damaging Het
Eps8l1 G A 7: 4,474,414 (GRCm39) S295N probably benign Het
Fer1l5 T A 1: 36,450,728 (GRCm39) M1242K probably benign Het
Gm3415 A G 5: 146,493,079 (GRCm39) R36G probably benign Het
Gm5797 C A 14: 7,330,318 (GRCm38) M114I possibly damaging Het
Gmppa A T 1: 75,418,468 (GRCm39) R284* probably null Het
Homer1 G C 13: 93,485,724 (GRCm39) K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,479,608 (GRCm39) probably benign Het
Kcnc4 G A 3: 107,366,019 (GRCm39) A63V probably damaging Het
Kif11 T A 19: 37,373,045 (GRCm39) I88N probably damaging Het
Krba1 T C 6: 48,379,831 (GRCm39) F9S probably damaging Het
Nckap1 A G 2: 80,350,714 (GRCm39) probably null Het
Nox4 A T 7: 86,954,097 (GRCm39) Y134F probably benign Het
Or4a79 T A 2: 89,552,237 (GRCm39) T73S probably benign Het
Or51f23c-ps1 T C 7: 102,431,465 (GRCm39) S261P probably benign Het
Or52e15 A G 7: 104,645,424 (GRCm39) L229P probably damaging Het
Or5m13b T A 2: 85,754,386 (GRCm39) M258K probably damaging Het
Or5m8 T C 2: 85,822,538 (GRCm39) C126R probably damaging Het
Or8k22 G T 2: 86,163,173 (GRCm39) H176N possibly damaging Het
Pcdh17 G T 14: 84,684,798 (GRCm39) V422L probably benign Het
Pcx T A 19: 4,653,157 (GRCm39) V275E probably damaging Het
Pde6h A T 6: 136,938,185 (GRCm39) M53L possibly damaging Het
Phactr3 A T 2: 177,975,861 (GRCm39) E535D probably damaging Het
Pkn3 C A 2: 29,980,539 (GRCm39) T810N probably damaging Het
Pnpla5 T C 15: 84,002,827 (GRCm39) E252G probably damaging Het
Pramel21 T A 4: 143,342,722 (GRCm39) C276* probably null Het
Psg17 A G 7: 18,548,530 (GRCm39) S414P probably benign Het
Pzp T A 6: 128,502,259 (GRCm39) Q30L probably benign Het
Reln A T 5: 22,491,894 (GRCm39) F113I possibly damaging Het
Sarnp A G 10: 128,713,235 (GRCm39) I209V probably benign Het
Sorl1 A T 9: 41,879,918 (GRCm39) V2210D probably damaging Het
Stard9 C T 2: 120,533,237 (GRCm39) Q3165* probably null Het
Tmem64 A T 4: 15,283,159 (GRCm39) I319F probably damaging Het
Vmn1r176 A T 7: 23,534,808 (GRCm39) V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 (GRCm39) T181A probably benign Het
Vmn2r2 T C 3: 64,024,334 (GRCm39) E749G possibly damaging Het
Vps35 G A 8: 86,010,677 (GRCm39) T222I possibly damaging Het
Zfp532 A G 18: 65,757,485 (GRCm39) T473A probably damaging Het
Zfyve16 A G 13: 92,657,712 (GRCm39) V733A probably damaging Het
Zranb1 T A 7: 132,551,723 (GRCm39) S125T probably benign Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118,152,081 (GRCm39) splice site probably null
IGL02445:Ret APN 6 118,158,860 (GRCm39) missense probably damaging 0.98
IGL02754:Ret APN 6 118,153,213 (GRCm39) missense probably benign 0.03
IGL02828:Ret APN 6 118,153,168 (GRCm39) missense probably benign 0.00
IGL03058:Ret APN 6 118,152,028 (GRCm39) missense probably damaging 1.00
R0126:Ret UTSW 6 118,142,956 (GRCm39) splice site probably benign
R0555:Ret UTSW 6 118,155,571 (GRCm39) missense probably damaging 0.96
R1168:Ret UTSW 6 118,150,519 (GRCm39) missense possibly damaging 0.94
R1829:Ret UTSW 6 118,130,912 (GRCm39) missense probably damaging 0.99
R2020:Ret UTSW 6 118,157,343 (GRCm39) missense possibly damaging 0.63
R4082:Ret UTSW 6 118,130,927 (GRCm39) missense possibly damaging 0.81
R4732:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R4733:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R5356:Ret UTSW 6 118,174,079 (GRCm39) missense possibly damaging 0.73
R5401:Ret UTSW 6 118,158,936 (GRCm39) missense probably benign 0.05
R5572:Ret UTSW 6 118,132,392 (GRCm39) missense probably damaging 1.00
R5669:Ret UTSW 6 118,161,204 (GRCm39) missense probably benign
R6058:Ret UTSW 6 118,156,280 (GRCm39) missense probably benign
R6087:Ret UTSW 6 118,153,252 (GRCm39) missense possibly damaging 0.53
R6412:Ret UTSW 6 118,161,245 (GRCm39) missense probably benign 0.00
R6457:Ret UTSW 6 118,150,582 (GRCm39) missense probably benign 0.01
R6884:Ret UTSW 6 118,132,362 (GRCm39) missense probably damaging 1.00
R7035:Ret UTSW 6 118,140,247 (GRCm39) missense probably damaging 1.00
R7112:Ret UTSW 6 118,174,063 (GRCm39) missense possibly damaging 0.96
R7841:Ret UTSW 6 118,132,321 (GRCm39) missense probably damaging 1.00
R7947:Ret UTSW 6 118,151,305 (GRCm39) missense probably benign 0.32
R8539:Ret UTSW 6 118,152,770 (GRCm39) missense possibly damaging 0.60
R8556:Ret UTSW 6 118,146,149 (GRCm39) missense probably damaging 1.00
R8742:Ret UTSW 6 118,155,484 (GRCm39) missense probably damaging 0.99
R8904:Ret UTSW 6 118,157,174 (GRCm39) splice site probably benign
R9051:Ret UTSW 6 118,142,888 (GRCm39) nonsense probably null
R9323:Ret UTSW 6 118,158,975 (GRCm39) missense probably benign 0.00
R9661:Ret UTSW 6 118,150,437 (GRCm39) missense probably benign
R9674:Ret UTSW 6 118,130,830 (GRCm39) missense probably damaging 1.00
Z1176:Ret UTSW 6 118,140,168 (GRCm39) missense probably damaging 1.00
Z1177:Ret UTSW 6 118,130,851 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TATCTCACGCCTGTTGATGG -3'
(R):5'- TACAGACGTAGACATCCGGG -3'

Sequencing Primer
(F):5'- CCTGTTGATGGCTTTCTGGC -3'
(R):5'- TAGACATCCGGGGTCCAC -3'
Posted On 2019-06-07