Incidental Mutation 'R0585:Pla2g2d'
ID55704
Institutional Source Beutler Lab
Gene Symbol Pla2g2d
Ensembl Gene ENSMUSG00000041202
Gene Namephospholipase A2, group IID
SynonymsmGIID, Splash
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0585 (G1)
Quality Score110
Status Validated
Chromosome4
Chromosomal Location138775735-138782046 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 138779393 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 50 (D50A)
Ref Sequence ENSEMBL: ENSMUSP00000101432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030528] [ENSMUST00000105806]
Predicted Effect probably benign
Transcript: ENSMUST00000030528
AA Change: D76A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030528
Gene: ENSMUSG00000041202
AA Change: D76A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 20 138 5.39e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105806
AA Change: D50A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101432
Gene: ENSMUSG00000041202
AA Change: D50A

DomainStartEndE-ValueType
PA2c 1 112 2.46e-42 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted member of the phospholipase A2 family, and is found in a cluster of related family members on chromosome 1. Phospholipase A2 family members hydrolyze the sn-2 fatty acid ester bond of glycerophospholipids to produce lysophospholipids and free fatty acid. This gene may be involved in inflammation and immune response, and in weight loss associated with chronic obstructive pulmonary disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired resolution of hapten-induced contact hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Pla2g2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02662:Pla2g2d APN 4 138778695 missense possibly damaging 0.93
R1888:Pla2g2d UTSW 4 138775815 start codon destroyed probably null
R1888:Pla2g2d UTSW 4 138775815 start codon destroyed probably null
R5666:Pla2g2d UTSW 4 138780280 missense probably damaging 1.00
R7842:Pla2g2d UTSW 4 138778778 missense probably damaging 0.99
R7925:Pla2g2d UTSW 4 138778778 missense probably damaging 0.99
Z1177:Pla2g2d UTSW 4 138775833 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGAGAGCCAGCCAGAGAAGTCAC -3'
(R):5'- GCTTGGTCGGACAGATTACAGAGG -3'

Sequencing Primer
(F):5'- ccaagtgtctcaaccccc -3'
(R):5'- CATGGCATTTCAGGGAGGTTAAAC -3'
Posted On2013-07-11