Incidental Mutation 'PIT4151001:Pcdh17'
ID557043
Institutional Source Beutler Lab
Gene Symbol Pcdh17
Ensembl Gene ENSMUSG00000035566
Gene Nameprotocadherin 17
SynonymsC030033F14Rik, LOC219228
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #PIT4151001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location84443563-84539002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84447358 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 422 (V422L)
Ref Sequence ENSEMBL: ENSMUSP00000071325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071370]
Predicted Effect probably benign
Transcript: ENSMUST00000071370
AA Change: V422L

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071325
Gene: ENSMUSG00000035566
AA Change: V422L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 54 131 6.8e-4 SMART
CA 155 242 8.81e-21 SMART
CA 266 350 8.27e-26 SMART
CA 375 468 9.14e-28 SMART
CA 492 579 8.4e-27 SMART
CA 608 687 2.53e-12 SMART
low complexity region 703 725 N/A INTRINSIC
low complexity region 751 759 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic transmission, increased synaptic vesicle number and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Pcdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pcdh17 APN 14 84447544 missense probably damaging 1.00
IGL00902:Pcdh17 APN 14 84446849 missense probably damaging 1.00
IGL01596:Pcdh17 APN 14 84448192 missense probably damaging 1.00
IGL01665:Pcdh17 APN 14 84447002 missense probably damaging 0.99
IGL01944:Pcdh17 APN 14 84447520 missense probably benign 0.01
IGL01944:Pcdh17 APN 14 84447521 missense probably damaging 0.98
IGL01977:Pcdh17 APN 14 84533097 missense possibly damaging 0.49
IGL01988:Pcdh17 APN 14 84446622 missense probably damaging 1.00
IGL02168:Pcdh17 APN 14 84533195 missense probably benign 0.19
IGL02500:Pcdh17 APN 14 84533469 missense probably benign 0.17
IGL02874:Pcdh17 APN 14 84448240 missense possibly damaging 0.71
IGL02882:Pcdh17 APN 14 84446661 missense probably damaging 0.98
IGL02941:Pcdh17 APN 14 84448307 missense probably damaging 1.00
IGL03328:Pcdh17 APN 14 84533111 missense probably benign
R0226_Pcdh17_958 UTSW 14 84448201 missense probably damaging 0.99
R3405_Pcdh17_345 UTSW 14 84446622 missense probably damaging 1.00
R0226:Pcdh17 UTSW 14 84448201 missense probably damaging 0.99
R0537:Pcdh17 UTSW 14 84447457 missense probably damaging 1.00
R0647:Pcdh17 UTSW 14 84447773 missense possibly damaging 0.58
R0939:Pcdh17 UTSW 14 84447755 missense probably damaging 1.00
R1014:Pcdh17 UTSW 14 84447488 missense probably damaging 1.00
R1753:Pcdh17 UTSW 14 84477654 missense probably benign 0.17
R3404:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3405:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3406:Pcdh17 UTSW 14 84446622 missense probably damaging 1.00
R3746:Pcdh17 UTSW 14 84533037 missense probably benign 0.02
R3852:Pcdh17 UTSW 14 84447259 nonsense probably null
R4015:Pcdh17 UTSW 14 84447107 missense probably damaging 0.99
R4348:Pcdh17 UTSW 14 84447620 missense probably damaging 0.97
R4365:Pcdh17 UTSW 14 84448286 missense probably damaging 0.97
R4375:Pcdh17 UTSW 14 84448271 missense possibly damaging 0.80
R4693:Pcdh17 UTSW 14 84533520 missense probably damaging 1.00
R4811:Pcdh17 UTSW 14 84447935 missense probably damaging 1.00
R5007:Pcdh17 UTSW 14 84533297 missense probably benign
R5074:Pcdh17 UTSW 14 84533342 missense probably benign
R5080:Pcdh17 UTSW 14 84533310 missense probably benign 0.01
R5138:Pcdh17 UTSW 14 84447209 missense probably damaging 1.00
R5330:Pcdh17 UTSW 14 84533046 missense probably damaging 1.00
R5541:Pcdh17 UTSW 14 84447416 missense probably damaging 0.97
R5686:Pcdh17 UTSW 14 84532993 missense probably damaging 1.00
R5692:Pcdh17 UTSW 14 84448540 missense probably benign 0.22
R5695:Pcdh17 UTSW 14 84446360 missense probably damaging 1.00
R5949:Pcdh17 UTSW 14 84447556 missense probably damaging 1.00
R6127:Pcdh17 UTSW 14 84533060 missense probably damaging 0.96
R6294:Pcdh17 UTSW 14 84477668 missense probably benign 0.01
R6508:Pcdh17 UTSW 14 84447979 missense probably damaging 1.00
R6726:Pcdh17 UTSW 14 84446217 missense probably damaging 1.00
R7094:Pcdh17 UTSW 14 84447395 missense probably damaging 1.00
R7137:Pcdh17 UTSW 14 84533549 missense possibly damaging 0.65
R7828:Pcdh17 UTSW 14 84532985 missense probably damaging 0.99
R7904:Pcdh17 UTSW 14 84448484 missense possibly damaging 0.94
R8507:Pcdh17 UTSW 14 84445944 start gained probably benign
X0025:Pcdh17 UTSW 14 84446562 missense possibly damaging 0.86
X0026:Pcdh17 UTSW 14 84533097 missense possibly damaging 0.49
X0027:Pcdh17 UTSW 14 84448310 missense possibly damaging 0.80
Z1088:Pcdh17 UTSW 14 84448274 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCAAGCTTATCGACCGGAAC -3'
(R):5'- TGGAGCACGTAAAGTCCTTTGG -3'

Sequencing Primer
(F):5'- ATAACGCGCCGTCCATTG -3'
(R):5'- CACGTAAAGTCCTTTGGTGAACCG -3'
Posted On2019-06-07