Incidental Mutation 'PIT4151001:Caskin1'
ID557049
Institutional Source Beutler Lab
Gene Symbol Caskin1
Ensembl Gene ENSMUSG00000033597
Gene NameCASK interacting protein 1
SynonymsC630036E02Rik, 3300002N10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #PIT4151001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24488783-24508905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24502219 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 511 (T511I)
Ref Sequence ENSEMBL: ENSMUSP00000024958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958]
Predicted Effect probably damaging
Transcript: ENSMUST00000024958
AA Change: T511I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597
AA Change: T511I

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Adam20 G A 8: 40,795,044 V64I possibly damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Caskin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Caskin1 APN 17 24503889 missense probably damaging 1.00
IGL00846:Caskin1 APN 17 24499349 critical splice donor site probably null
IGL01120:Caskin1 APN 17 24505369 missense possibly damaging 0.56
IGL01543:Caskin1 APN 17 24504548 missense probably benign
IGL01622:Caskin1 APN 17 24503940 critical splice donor site probably null
IGL01623:Caskin1 APN 17 24503940 critical splice donor site probably null
IGL02120:Caskin1 APN 17 24500942 missense probably damaging 1.00
IGL02816:Caskin1 APN 17 24502170 missense probably benign 0.06
IGL02898:Caskin1 APN 17 24502409 missense probably benign 0.00
IGL03353:Caskin1 APN 17 24499357 splice site probably benign
PIT4453001:Caskin1 UTSW 17 24499292 missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24504896 missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24504896 missense probably damaging 1.00
R0190:Caskin1 UTSW 17 24504622 missense possibly damaging 0.92
R0443:Caskin1 UTSW 17 24505400 missense probably damaging 0.96
R0885:Caskin1 UTSW 17 24505694 missense probably damaging 1.00
R1035:Caskin1 UTSW 17 24505037 missense probably damaging 1.00
R1253:Caskin1 UTSW 17 24505073 missense probably damaging 1.00
R1497:Caskin1 UTSW 17 24504541 nonsense probably null
R1589:Caskin1 UTSW 17 24505478 unclassified probably null
R1651:Caskin1 UTSW 17 24502212 missense possibly damaging 0.82
R1944:Caskin1 UTSW 17 24500771 missense probably damaging 0.99
R1969:Caskin1 UTSW 17 24506850 missense possibly damaging 0.94
R2057:Caskin1 UTSW 17 24496459 missense probably damaging 0.99
R2127:Caskin1 UTSW 17 24496996 critical splice donor site probably null
R2158:Caskin1 UTSW 17 24505154 missense probably benign
R2402:Caskin1 UTSW 17 24503808 missense probably damaging 1.00
R2895:Caskin1 UTSW 17 24489042 missense probably damaging 1.00
R3423:Caskin1 UTSW 17 24499565 missense probably damaging 0.98
R3800:Caskin1 UTSW 17 24501272 missense probably benign
R4108:Caskin1 UTSW 17 24502147 missense probably benign
R4419:Caskin1 UTSW 17 24504709 missense probably damaging 1.00
R4510:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4511:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4552:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4638:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4642:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4644:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4824:Caskin1 UTSW 17 24501129 missense probably benign 0.01
R4882:Caskin1 UTSW 17 24504415 missense probably damaging 1.00
R4964:Caskin1 UTSW 17 24507161 missense probably damaging 1.00
R4966:Caskin1 UTSW 17 24507161 missense probably damaging 1.00
R5809:Caskin1 UTSW 17 24504547 missense probably benign 0.06
R5841:Caskin1 UTSW 17 24496209 missense probably damaging 0.99
R5877:Caskin1 UTSW 17 24505265 missense possibly damaging 0.69
R5960:Caskin1 UTSW 17 24498895 missense probably benign 0.31
R5994:Caskin1 UTSW 17 24496961 missense probably damaging 0.98
R6022:Caskin1 UTSW 17 24496735 missense probably benign 0.37
R6209:Caskin1 UTSW 17 24507121 missense possibly damaging 0.84
R6228:Caskin1 UTSW 17 24507180 missense probably damaging 0.99
R6287:Caskin1 UTSW 17 24496709 missense probably damaging 1.00
R6497:Caskin1 UTSW 17 24504548 missense probably benign
R6873:Caskin1 UTSW 17 24504179 missense probably benign 0.31
R7079:Caskin1 UTSW 17 24498884 missense probably benign 0.31
R7156:Caskin1 UTSW 17 24500683 splice site probably null
R7385:Caskin1 UTSW 17 24503924 missense probably damaging 1.00
X0022:Caskin1 UTSW 17 24505166 missense probably benign 0.34
X0063:Caskin1 UTSW 17 24507182 missense probably damaging 1.00
Z1176:Caskin1 UTSW 17 24505038 missense probably damaging 1.00
Z1177:Caskin1 UTSW 17 24496687 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTCTGGCCATGAACCAAG -3'
(R):5'- CAAGGAGCCTTACGGGTTTG -3'

Sequencing Primer
(F):5'- TCTGGCCATGAACCAAGCAGAG -3'
(R):5'- CAGCCAGTCAGGGATGTTCAG -3'
Posted On2019-06-07