Incidental Mutation 'R6825:Clcn2'
ID 557056
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms ClC-2, nmf240, Clc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock # R6825 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 20702964-20717746 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) C to A at 20709658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000232309]
AlphaFold Q9R0A1
Predicted Effect silent
Transcript: ENSMUST00000007207
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120099
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131522
AA Change: W496L
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843
AA Change: W496L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231381
Predicted Effect silent
Transcript: ENSMUST00000232309
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,907,880 S206T probably benign Het
Aasdh A T 5: 76,888,849 probably null Het
Adam10 G T 9: 70,761,602 C400F probably damaging Het
Ankle2 A T 5: 110,250,769 R561S probably null Het
Arhgef5 C T 6: 43,274,961 T882I probably damaging Het
Arpc1a A T 5: 145,096,126 K82* probably null Het
Card11 C A 5: 140,878,082 R967L probably benign Het
Ccdc82 G T 9: 13,251,976 probably benign Het
Cebpz T C 17: 78,919,963 D1026G probably damaging Het
Cit A T 5: 115,981,774 Q1321L probably damaging Het
Csf3 G C 11: 98,702,447 G130A probably damaging Het
Cul2 T A 18: 3,434,946 S737T probably damaging Het
Cyp1a2 G A 9: 57,677,260 H504Y probably benign Het
Cyp3a44 G A 5: 145,779,586 P398L probably damaging Het
Dnah8 T C 17: 30,741,173 I2206T probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epb41l5 A T 1: 119,620,201 D157E possibly damaging Het
Ercc8 T C 13: 108,158,809 S6P probably damaging Het
Faxc T C 4: 21,931,672 S37P probably benign Het
Fbxl19 T A 7: 127,750,015 I119K probably damaging Het
Frmd4b A G 6: 97,325,476 V195A possibly damaging Het
Fut9 A T 4: 25,619,925 S296R probably benign Het
Gas6 T C 8: 13,483,674 N112D probably benign Het
H2-Q1 T C 17: 35,321,052 L99P probably damaging Het
Helq A T 5: 100,792,695 I346N probably damaging Het
Hepacam A G 9: 37,367,680 K2E possibly damaging Het
Itgae T C 11: 73,118,496 M502T possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Macf1 A T 4: 123,383,222 probably null Het
Mgat4a T A 1: 37,464,434 K220* probably null Het
Olfr1199 T C 2: 88,755,911 I255V possibly damaging Het
Olfr1469 G A 19: 13,411,150 V194I probably benign Het
Olfr224 T C 11: 58,566,650 R232G possibly damaging Het
Pex5 A T 6: 124,414,381 M18K probably damaging Het
Phlda3 T C 1: 135,766,824 *126Q probably null Het
Plxna1 G T 6: 89,320,615 D1862E probably benign Het
Pold4 A T 19: 4,232,110 I7F possibly damaging Het
Prkaa1 A T 15: 5,143,950 I19F possibly damaging Het
Prl7d1 T G 13: 27,710,142 E148A probably benign Het
Prr14l A T 5: 32,828,548 V1201E possibly damaging Het
Rab3gap1 T C 1: 127,930,421 C510R probably damaging Het
Rhbdf1 C T 11: 32,209,970 R802H probably damaging Het
Rpl18a A C 8: 70,896,192 F47V probably damaging Het
Sema5b C A 16: 35,628,007 probably null Het
Sspo G A 6: 48,465,525 G1985R probably benign Het
Tcaf2 C T 6: 42,629,518 A501T probably benign Het
Tcerg1 A G 18: 42,548,477 D563G probably damaging Het
Tdh G A 14: 63,495,832 T155M probably damaging Het
Tenm2 T C 11: 36,046,884 N1654S probably benign Het
Tlr5 A T 1: 182,973,044 probably benign Het
Tns1 G T 1: 74,002,323 C136* probably null Het
Tomm5 A T 4: 45,106,443 probably null Het
Trio A T 15: 27,889,308 F512I probably damaging Het
Ttll5 A T 12: 85,883,328 probably null Het
Upp1 T A 11: 9,131,707 H81Q probably benign Het
Usp42 A G 5: 143,727,807 S71P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Zap70 A G 1: 36,778,390 Y238C probably damaging Het
Zfp398 A G 6: 47,866,331 D307G probably damaging Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20703641 missense probably benign 0.08
IGL01657:Clcn2 APN 16 20713619 missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20712761 missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20708464 missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20703348 missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20709256 nonsense probably null
IGL03329:Clcn2 APN 16 20712152 missense probably damaging 1.00
Bemr14 UTSW 16 unclassified
R0008:Clcn2 UTSW 16 20710390 missense probably null 1.00
R0454:Clcn2 UTSW 16 20710428 critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20703595 missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20712552 splice site probably benign
R1824:Clcn2 UTSW 16 20715962 missense probably benign 0.04
R4592:Clcn2 UTSW 16 20709142 missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20703303 missense probably benign 0.01
R5374:Clcn2 UTSW 16 20709669 missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20710535 intron probably benign
R5787:Clcn2 UTSW 16 20703433 missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20713654 missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20711688 critical splice donor site probably null
R6663:Clcn2 UTSW 16 20703245 makesense probably null
R6765:Clcn2 UTSW 16 20707668 splice site probably null
R7872:Clcn2 UTSW 16 20708460 missense probably damaging 0.99
R8028:Clcn2 UTSW 16 20708762 missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20707196 missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20713418 missense probably damaging 1.00
R8924:Clcn2 UTSW 16 20712180 missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20712330 missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20712664 missense possibly damaging 0.78
R9101:Clcn2 UTSW 16 20707229 missense probably benign 0.00
R9456:Clcn2 UTSW 16 20715952 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTCCCAAAGAGTAATCGGGC -3'
(R):5'- GCTATGGCTTGTAGAGTTCAAC -3'

Sequencing Primer
(F):5'- GTCTCCAAATGCAGCTATGGACTG -3'
(R):5'- GAGTTCAACTCTAGCCCAAACC -3'
Posted On 2019-06-07