Mutagenetix > Incidental Mutations

Incidental Mutation 'R0585:Brdt'

55706

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

038775-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0585 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to G at 107356882 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000031215

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162804

Meta Mutation Damage Score

0.9491

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.2%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,550,723	V267A	probably benign	Het
9530003J23Rik	T	A	10: 117,238,451	I44F	possibly damaging	Het
Ccdc162	C	T	10: 41,586,379	C1474Y	probably benign	Het
Ces2e	T	C	8: 104,929,821	S228P	probably damaging	Het
Clca1	G	T	3: 145,032,625	H41N	probably benign	Het
Cyp2c39	A	T	19: 39,536,759	I169F	probably benign	Het
Cyp2c65	A	G	19: 39,069,242	K107R	probably benign	Het
Cyp2c67	T	A	19: 39,638,694	N231Y	possibly damaging	Het
Eps8l3	G	C	3: 107,881,197	D33H	probably damaging	Het
Evi5	T	C	5: 107,813,536		probably benign	Het
Fcho1	T	C	8: 71,715,725	Y218C	probably damaging	Het
Gm3993	T	A	12: 20,072,148		probably null	Het
Gtf2ird1	A	C	5: 134,376,942	L28R	probably damaging	Het
Hsf4	A	G	8: 105,271,031	D75G	probably damaging	Het
Larp4b	A	G	13: 9,147,493	T249A	probably damaging	Het
Larp4b	A	G	13: 9,170,701	D578G	probably benign	Het
Matn3	A	T	12: 8,961,103		probably benign	Het
Myo10	T	A	15: 25,736,455	Y428N	probably damaging	Het
Nf1	T	A	11: 79,568,701	D661E	probably damaging	Het
Nktr	A	G	9: 121,754,280		probably benign	Het
Npbwr1	G	A	1: 5,916,458	T279I	possibly damaging	Het
Olfr665	A	C	7: 104,881,499	H264P	probably damaging	Het
Osmr	T	C	15: 6,837,793	I341V	probably benign	Het
Pan2	T	C	10: 128,310,515		probably null	Het
Pknox2	G	A	9: 36,909,760		probably benign	Het
Pla2g2d	A	C	4: 138,779,393	D50A	probably benign	Het
Ptprk	C	T	10: 28,575,668	L1051F	probably damaging	Het
Rap1gds1	G	A	3: 139,021,872	T59M	probably benign	Het
Rps5	T	C	7: 12,925,405	V41A	possibly damaging	Het
Ryr1	G	T	7: 29,036,076	D4092E	probably damaging	Het
Spic	T	C	10: 88,676,043	Y117C	probably damaging	Het
Thrap3	A	T	4: 126,178,574		probably null	Het
Tlr9	C	T	9: 106,225,076	T522I	probably benign	Het
Tspan3	A	T	9: 56,145,932		probably benign	Het
Ttn	T	C	2: 76,873,159		probably benign	Het
Zfp773	T	A	7: 7,132,575	I341L	probably benign	Het
Zmat3	G	A	3: 32,361,105	P19S	probably damaging	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R8958:Brdt	UTSW	5	107378011	missense	probably benign
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- AAGCTGCCCTATCAGGCCATTTATG -3'
(R):5'- GCTGCTAACGCTTACAACTAAACGG -3'

Sequencing Primer
(F):5'- GCCATCATCTTACCCAGACATTG -3'
(R):5'- GACAACCCTCCACAGTGTAATAAG -3'

Posted On

2013-07-11