Incidental Mutation 'R0585:Brdt'
ID55706
Institutional Source Beutler Lab
Gene Symbol Brdt
Ensembl Gene ENSMUSG00000029279
Gene Namebromodomain, testis-specific
SynonymsFsrg3, 7420412D09Rik, Brd6
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0585 (G1)
Quality Score99
Status Validated
Chromosome5
Chromosomal Location107331159-107387058 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 107356882 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031215]
PDB Structure
Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000031215
SMART Domains Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
BROMO 268 377 2.18e-40 SMART
low complexity region 392 417 N/A INTRINSIC
low complexity region 446 455 N/A INTRINSIC
low complexity region 472 500 N/A INTRINSIC
Pfam:BET 505 569 9.2e-34 PFAM
low complexity region 585 603 N/A INTRINSIC
low complexity region 649 691 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
Pfam:BRD4_CDT 913 956 3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162804
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Brdt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Brdt APN 5 107342203 missense probably damaging 1.00
IGL02718:Brdt APN 5 107350068 splice site probably benign
IGL02746:Brdt APN 5 107370324 missense probably benign
IGL02851:Brdt APN 5 107377995 missense possibly damaging 0.47
R0708:Brdt UTSW 5 107358900 nonsense probably null
R1338:Brdt UTSW 5 107350188 missense probably benign 0.02
R1710:Brdt UTSW 5 107343584 missense probably damaging 1.00
R1794:Brdt UTSW 5 107359853 small deletion probably benign
R1861:Brdt UTSW 5 107359458 missense probably benign
R1913:Brdt UTSW 5 107348613 missense probably benign
R2029:Brdt UTSW 5 107359224 missense probably benign 0.35
R2431:Brdt UTSW 5 107378015 synonymous probably null
R3121:Brdt UTSW 5 107377145 missense probably damaging 0.99
R3122:Brdt UTSW 5 107377145 missense probably damaging 0.99
R4258:Brdt UTSW 5 107359909 missense probably damaging 0.97
R4609:Brdt UTSW 5 107359936 missense probably benign 0.00
R5306:Brdt UTSW 5 107345144 missense probably damaging 1.00
R5640:Brdt UTSW 5 107359308 nonsense probably null
R5677:Brdt UTSW 5 107348617 missense possibly damaging 0.85
R5936:Brdt UTSW 5 107359395 missense probably damaging 1.00
R6145:Brdt UTSW 5 107377999 missense possibly damaging 0.67
R6261:Brdt UTSW 5 107348503 missense probably benign 0.04
R6408:Brdt UTSW 5 107385492 missense probably damaging 1.00
R6930:Brdt UTSW 5 107359215 missense probably benign 0.35
R7372:Brdt UTSW 5 107370294 missense possibly damaging 0.49
R7741:Brdt UTSW 5 107358886 missense probably benign 0.00
R7842:Brdt UTSW 5 107348588 missense possibly damaging 0.49
R7869:Brdt UTSW 5 107370179 missense probably benign 0.04
R7887:Brdt UTSW 5 107359933 missense possibly damaging 0.66
R7925:Brdt UTSW 5 107348588 missense possibly damaging 0.49
R7952:Brdt UTSW 5 107370179 missense probably benign 0.04
R8064:Brdt UTSW 5 107377996 nonsense probably null
X0011:Brdt UTSW 5 107342128 missense probably damaging 0.96
X0011:Brdt UTSW 5 107377092 missense probably damaging 1.00
Z1176:Brdt UTSW 5 107359898 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAGCTGCCCTATCAGGCCATTTATG -3'
(R):5'- GCTGCTAACGCTTACAACTAAACGG -3'

Sequencing Primer
(F):5'- GCCATCATCTTACCCAGACATTG -3'
(R):5'- GACAACCCTCCACAGTGTAATAAG -3'
Posted On2013-07-11