Mutagenetix > Incidental Mutation

Incidental Mutation 'R6956:Rpgrip1l'

557064

Institutional Source

Beutler Lab

Gene Symbol

Rpgrip1l

Ensembl Gene

ENSMUSG00000033282

Gene Name

Rpgrip1-like

Synonyms

Nphp8, fantom, Ftm, 1700047E16Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6956 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91217030-91313262 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 91286313 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000042702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113]

AlphaFold

Q8CG73

Predicted Effect

probably null
Transcript: ENSMUST00000047783

SMART Domains

Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC
coiled coil region	196	268	N/A	INTRINSIC
coiled coil region	299	371	N/A	INTRINSIC
coiled coil region	395	454	N/A	INTRINSIC
coiled coil region	520	556	N/A	INTRINSIC
Pfam:C2-C2_1	597	738	5.8e-61	PFAM
low complexity region	769	778	N/A	INTRINSIC
C2	791	896	1.06e-5	SMART
low complexity region	989	1000	N/A	INTRINSIC
low complexity region	1057	1080	N/A	INTRINSIC
Blast:C2	1098	1223	3e-20	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000139113

SMART Domains

Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (43/43)

MGI Phenotype

Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	T	A	14: 95,882,433	W209R	probably damaging	Het
Aars	G	A	8: 111,055,130	V945M	probably benign	Het
Amotl2	A	G	9: 102,724,768	T371A	probably damaging	Het
Bmpr1a	A	G	14: 34,441,175	I86T	possibly damaging	Het
C9	A	T	15: 6,445,464	M35L	probably benign	Het
Cc2d1a	G	T	8: 84,135,899	P661T	probably damaging	Het
Dcdc2a	T	A	13: 25,119,366	S293R	probably benign	Het
Dchs2	T	A	3: 83,353,926	N2500K	probably benign	Het
Dicer1	A	G	12: 104,731,023	S92P	probably damaging	Het
Dnah7a	T	A	1: 53,577,287	I1172F	probably benign	Het
Dnajc6	A	G	4: 101,614,273	S364G	probably damaging	Het
Dpp6	A	T	5: 27,598,821	N255I	probably damaging	Het
Eif2ak4	T	C	2: 118,422,267	I440T	probably damaging	Het
Fam155a	T	A	8: 9,770,744	Q92L	probably benign	Het
Fam184b	T	C	5: 45,530,757	T937A	probably damaging	Het
Fam229b	T	A	10: 39,133,847		probably null	Het
Gbp11	A	G	5: 105,328,375		probably null	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm4858	T	C	3: 93,073,972	V25A	possibly damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
H2-T3	T	A	17: 36,189,371	Y144F	probably damaging	Het
Kel	T	G	6: 41,687,973	D7A	probably damaging	Het
Lrrc7	A	G	3: 158,289,031	V166A	probably benign	Het
Mapt	T	C	11: 104,318,255		probably null	Het
March3	A	G	18: 56,775,981	V244A	probably benign	Het
Mboat1	T	C	13: 30,238,076	V396A	possibly damaging	Het
Mphosph9	T	C	5: 124,297,558	D604G	probably damaging	Het
Muc16	T	C	9: 18,645,026	T3324A	unknown	Het
Nat10	T	C	2: 103,734,412	I495V	probably benign	Het
Olfr784	A	T	10: 129,388,297	K221N	probably benign	Het
Pfkfb2	T	C	1: 130,707,600	N75D	probably damaging	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Scube1	T	C	15: 83,721,876	Y65C	probably damaging	Het
Slc12a4	A	G	8: 105,953,852	F211L	probably damaging	Het
Socs7	T	C	11: 97,377,023	S327P	probably benign	Het
Spef2	A	T	15: 9,684,935	D591E	probably damaging	Het
Sult2a6	T	A	7: 14,254,823	D4V	possibly damaging	Het
Tdrd9	A	G	12: 112,036,354		probably benign	Het
Tgm4	G	T	9: 123,064,703	M155I	possibly damaging	Het
Togaram2	T	C	17: 71,729,188	V891A	probably benign	Het
Usp1	A	G	4: 98,931,006	E235G	probably damaging	Het
Usp2	T	A	9: 44,092,756	V533E	probably damaging	Het
Vcan	T	A	13: 89,689,431	I2665F	probably damaging	Het
Vmn2r31	G	A	7: 7,394,506	S251L	probably benign	Het
Vmn2r84	C	A	10: 130,389,267	C458F	probably damaging	Het

Other mutations in Rpgrip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rpgrip1l	APN	8	91263574	missense	possibly damaging	0.52
IGL00932:Rpgrip1l	APN	8	91275637	missense	probably benign	0.33
IGL01113:Rpgrip1l	APN	8	91260739	intron	probably benign
IGL01151:Rpgrip1l	APN	8	91275149	missense	probably damaging	1.00
IGL01321:Rpgrip1l	APN	8	91260873	nonsense	probably null
IGL01384:Rpgrip1l	APN	8	91273640	missense	probably benign	0.00
IGL01634:Rpgrip1l	APN	8	91252543	missense	probably benign
IGL01634:Rpgrip1l	APN	8	91252544	missense	probably benign	0.25
IGL01781:Rpgrip1l	APN	8	91270218	missense	probably benign	0.16
IGL01784:Rpgrip1l	APN	8	91270461	missense	possibly damaging	0.56
IGL02034:Rpgrip1l	APN	8	91251148	critical splice donor site	probably null
IGL02250:Rpgrip1l	APN	8	91232861	missense	probably benign	0.00
IGL02285:Rpgrip1l	APN	8	91232907	missense	possibly damaging	0.92
IGL02634:Rpgrip1l	APN	8	91225344	splice site	probably benign
IGL02736:Rpgrip1l	APN	8	91263591	missense	possibly damaging	0.91
IGL02825:Rpgrip1l	APN	8	91304805	missense	possibly damaging	0.67
IGL02962:Rpgrip1l	APN	8	91270362	missense	possibly damaging	0.95
IGL03031:Rpgrip1l	APN	8	91260783	missense	probably damaging	1.00
IGL03184:Rpgrip1l	APN	8	91300809	missense	probably damaging	1.00
P0005:Rpgrip1l	UTSW	8	91299225	splice site	probably benign
R0118:Rpgrip1l	UTSW	8	91270122	missense	probably damaging	1.00
R0490:Rpgrip1l	UTSW	8	91299845	splice site	probably benign
R0599:Rpgrip1l	UTSW	8	91305000	missense	probably damaging	1.00
R1514:Rpgrip1l	UTSW	8	91260750	missense	probably damaging	1.00
R1648:Rpgrip1l	UTSW	8	91252889	missense	probably damaging	1.00
R1914:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R1915:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R2093:Rpgrip1l	UTSW	8	91270132	missense	possibly damaging	0.87
R2225:Rpgrip1l	UTSW	8	91221467	missense	probably benign	0.45
R2504:Rpgrip1l	UTSW	8	91280716	critical splice donor site	probably null
R3859:Rpgrip1l	UTSW	8	91263658	missense	probably benign	0.00
R4118:Rpgrip1l	UTSW	8	91252907	missense	probably benign
R4801:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4802:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4921:Rpgrip1l	UTSW	8	91261009	missense	probably benign	0.05
R4976:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5092:Rpgrip1l	UTSW	8	91221384	nonsense	probably null
R5099:Rpgrip1l	UTSW	8	91248722	missense	probably benign	0.20
R5119:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5141:Rpgrip1l	UTSW	8	91260918	missense	probably benign	0.29
R5793:Rpgrip1l	UTSW	8	91260772	missense	probably benign	0.06
R5847:Rpgrip1l	UTSW	8	91304985	missense	probably damaging	1.00
R5871:Rpgrip1l	UTSW	8	91221386	missense	possibly damaging	0.89
R5916:Rpgrip1l	UTSW	8	91252913	missense	possibly damaging	0.93
R6619:Rpgrip1l	UTSW	8	91232871	missense	possibly damaging	0.69
R6654:Rpgrip1l	UTSW	8	91220205	missense	probably benign	0.36
R6984:Rpgrip1l	UTSW	8	91260798	missense	probably benign	0.03
R7064:Rpgrip1l	UTSW	8	91263520	nonsense	probably null
R7145:Rpgrip1l	UTSW	8	91232806	critical splice donor site	probably null
R7243:Rpgrip1l	UTSW	8	91270123	missense	probably benign	0.00
R7673:Rpgrip1l	UTSW	8	91300787	missense	possibly damaging	0.89
R7796:Rpgrip1l	UTSW	8	91270237	missense	probably damaging	1.00
R8684:Rpgrip1l	UTSW	8	91273701	missense	probably benign	0.00
R8769:Rpgrip1l	UTSW	8	91252584	splice site	probably benign
R8955:Rpgrip1l	UTSW	8	91280828	missense	possibly damaging	0.67
R9006:Rpgrip1l	UTSW	8	91280808	missense	probably benign
R9085:Rpgrip1l	UTSW	8	91287675	missense	possibly damaging	0.68
R9188:Rpgrip1l	UTSW	8	91305010	missense	probably damaging	1.00
R9258:Rpgrip1l	UTSW	8	91260986	nonsense	probably null
R9268:Rpgrip1l	UTSW	8	91280727	missense	probably benign
R9366:Rpgrip1l	UTSW	8	91270181	nonsense	probably null
R9547:Rpgrip1l	UTSW	8	91251245	missense	probably benign	0.00
R9565:Rpgrip1l	UTSW	8	91304888	missense	probably benign	0.05
R9582:Rpgrip1l	UTSW	8	91270258	missense	probably benign	0.03
R9604:Rpgrip1l	UTSW	8	91304805	missense	possibly damaging	0.67
R9614:Rpgrip1l	UTSW	8	91260806	missense	possibly damaging	0.79
R9697:Rpgrip1l	UTSW	8	91260763	missense	possibly damaging	0.49
Z1088:Rpgrip1l	UTSW	8	91220179	makesense	probably null
Z1088:Rpgrip1l	UTSW	8	91260975	missense	possibly damaging	0.96
Z1088:Rpgrip1l	UTSW	8	91270120	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CAGTGACTAATGCCTTTAGAAAGC -3'
(R):5'- AATTGAATGCAGGCTCCGTG -3'

Sequencing Primer
(F):5'- TCATGTCATGATCTGCTGCTAG -3'
(R):5'- CTCCGTGTGTGCTGTAGTCAG -3'

Posted On

2019-06-07