Incidental Mutation 'R6948:Slc22a14'
ID557069
Institutional Source Beutler Lab
Gene Symbol Slc22a14
Ensembl Gene ENSMUSG00000070280
Gene Namesolute carrier family 22 (organic cation transporter), member 14
SynonymsLOC382113
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6948 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location119169455-119365553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119231416 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 93 (A93S)
Ref Sequence ENSEMBL: ENSMUSP00000134667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170400] [ENSMUST00000173185]
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173185
AA Change: A93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134667
Gene: ENSMUSG00000092212
AA Change: A93S

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:MFS_1 141 349 3.4e-12 PFAM
Pfam:Sugar_tr 162 333 7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 3. The encoded protein is a transmembrane protein which is thought to transport small molecules and since this protein is conserved among several species, it is suggested to have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap2 A G 2: 91,267,179 T107A probably benign Het
Calhm3 T A 19: 47,151,905 M250L probably damaging Het
Catsperb A T 12: 101,481,068 I276L probably benign Het
Ccdc129 C T 6: 55,978,485 T1026I probably benign Het
Cd70 T C 17: 57,149,594 E3G probably damaging Het
Cenpj A T 14: 56,553,226 S455R probably damaging Het
Cgn C G 3: 94,773,221 E590D probably benign Het
Cpvl T A 6: 53,896,483 I423F possibly damaging Het
Cyp2c54 T A 19: 40,046,192 M345L possibly damaging Het
Dner T C 1: 84,406,017 N549D probably damaging Het
Fat4 T A 3: 39,009,446 L4517Q probably damaging Het
Fbxw11 A G 11: 32,742,597 T523A probably damaging Het
Flg A G 3: 93,288,168 probably benign Het
Gcfc2 A G 6: 81,933,753 E237G probably benign Het
Ipo5 G T 14: 120,923,115 M181I probably benign Het
Klhl32 A G 4: 24,629,250 Y506H probably benign Het
Mast3 G A 8: 70,785,482 T505I probably damaging Het
Mrgprx2 A T 7: 48,482,716 V118D possibly damaging Het
Mtor T G 4: 148,536,752 V1869G probably benign Het
Mycbp2 A T 14: 103,285,267 M720K possibly damaging Het
Npy4r A G 14: 34,146,774 Y186H probably benign Het
Obscn A G 11: 59,106,316 S1520P probably damaging Het
Olfr1511 A T 14: 52,390,157 F205L probably benign Het
Pex1 A G 5: 3,605,994 N274D probably benign Het
Plxnb1 T C 9: 109,116,634 Y2078H probably damaging Het
Rasgrp1 T C 2: 117,298,604 D178G probably damaging Het
Reln A G 5: 21,972,035 S1878P probably damaging Het
Rims2 T C 15: 39,511,341 V1033A probably benign Het
Scaf1 G T 7: 45,013,547 S14* probably null Het
Serpinb9d A G 13: 33,200,723 S228G possibly damaging Het
Sox30 G A 11: 46,017,339 V778M probably damaging Het
Tecrl T C 5: 83,309,250 I128V probably benign Het
Trip10 T A 17: 57,262,448 C491S probably damaging Het
Vmn1r26 A T 6: 58,008,733 M157K probably damaging Het
Zbtb1 A T 12: 76,385,827 S196C probably damaging Het
Zfp236 T C 18: 82,644,062 D582G possibly damaging Het
Zfp384 A G 6: 125,024,910 T125A probably benign Het
Zpr1 T G 9: 46,273,641 probably null Het
Other mutations in Slc22a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Slc22a14 APN 9 119178513 missense possibly damaging 0.58
R0086:Slc22a14 UTSW 9 119222738 critical splice donor site probably benign
R0505:Slc22a14 UTSW 9 119172034 splice site probably benign
R0593:Slc22a14 UTSW 9 119169851 missense probably benign 0.15
R0597:Slc22a14 UTSW 9 119172124 missense probably damaging 0.99
R0674:Slc22a14 UTSW 9 119178542 missense probably damaging 1.00
R1290:Slc22a14 UTSW 9 119178452 missense probably damaging 1.00
R1459:Slc22a14 UTSW 9 119223761 missense possibly damaging 0.70
R1706:Slc22a14 UTSW 9 119180984 missense probably benign 0.06
R3980:Slc22a14 UTSW 9 119178486 missense probably benign 0.02
R4166:Slc22a14 UTSW 9 119178432 missense probably benign 0.00
R4166:Slc22a14 UTSW 9 119179868 missense possibly damaging 0.53
R4574:Slc22a14 UTSW 9 119179495 missense probably damaging 0.99
R4959:Slc22a14 UTSW 9 119174035 small deletion probably benign
R4973:Slc22a14 UTSW 9 119174035 small deletion probably benign
R5273:Slc22a14 UTSW 9 119170638 missense probably benign 0.08
R5330:Slc22a14 UTSW 9 119230596 missense probably damaging 1.00
R5331:Slc22a14 UTSW 9 119230596 missense probably damaging 1.00
R5543:Slc22a14 UTSW 9 119173608 missense probably benign 0.01
R5801:Slc22a14 UTSW 9 119172083 missense probably benign 0.01
R6521:Slc22a14 UTSW 9 119220769 intron probably null
R6622:Slc22a14 UTSW 9 119170577 missense possibly damaging 0.81
R7027:Slc22a14 UTSW 9 119231215 intron probably null
R7731:Slc22a14 UTSW 9 119170611 missense possibly damaging 0.95
R7985:Slc22a14 UTSW 9 119170638 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATCAGAGGCACAGGGTCAG -3'
(R):5'- ACAGGTCATGGCTGAAGTGG -3'

Sequencing Primer
(F):5'- GGTCAGACAGAGTACCTGACAC -3'
(R):5'- TTCAGGTGCGGTTGACCATCC -3'
Posted On2019-06-10