Incidental Mutation 'R6971:C1qtnf7'
ID557070
Institutional Source Beutler Lab
Gene Symbol C1qtnf7
Ensembl Gene ENSMUSG00000061535
Gene NameC1q and tumor necrosis factor related protein 7
Synonyms5530401N20Rik, CTRP7, 8430425G24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6971 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location43515538-43618803 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 43609050 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076939] [ENSMUST00000121872] [ENSMUST00000144558]
Predicted Effect probably null
Transcript: ENSMUST00000076939
SMART Domains Protein: ENSMUSP00000076206
Gene: ENSMUSG00000061535

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Collagen 36 93 2.9e-11 PFAM
Pfam:Collagen 82 139 7.4e-11 PFAM
C1Q 141 276 1.05e-45 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121872
SMART Domains Protein: ENSMUSP00000113520
Gene: ENSMUSG00000061535

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Collagen 36 93 2.9e-11 PFAM
Pfam:Collagen 82 139 7.4e-11 PFAM
C1Q 141 276 1.05e-45 SMART
Predicted Effect probably null
Transcript: ENSMUST00000144558
SMART Domains Protein: ENSMUSP00000120917
Gene: ENSMUSG00000061535

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Collagen 35 68 5.5e-7 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased weight, liver fibrosis, male-specific glucose serum levels and adipose inflammation with male-specific improved glucose tolerance when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A T 10: 87,165,041 T32S possibly damaging Het
2210408I21Rik A G 13: 77,193,187 S52G possibly damaging Het
Aadacl4 G A 4: 144,622,733 V187M probably damaging Het
Adprhl1 T A 8: 13,223,476 Q1094L probably benign Het
Amigo1 C T 3: 108,188,136 S317L probably benign Het
Brca1 A G 11: 101,534,005 F32L probably benign Het
Ccdc88c A T 12: 100,954,227 D378E probably damaging Het
Ccdc97 G T 7: 25,714,959 Y123* probably null Het
Cdk10 T A 8: 123,227,674 M46K probably damaging Het
Dsc3 A G 18: 19,966,218 probably null Het
Ephx3 T A 17: 32,188,203 N254Y possibly damaging Het
Fnip2 G A 3: 79,481,121 R768* probably null Het
Glra1 A T 11: 55,536,499 Y3* probably null Het
Gltpd2 A G 11: 70,520,464 T194A probably damaging Het
Hectd1 A T 12: 51,748,743 L2301* probably null Het
Hmcn1 T A 1: 150,993,051 M1L probably benign Het
Hmcn2 G A 2: 31,432,321 E4133K probably benign Het
Hps3 A T 3: 20,011,535 L714I probably damaging Het
Igfbpl1 A G 4: 45,816,333 V164A possibly damaging Het
Ip6k2 T C 9: 108,797,311 probably benign Het
Itgb8 A T 12: 119,190,631 Y224N probably damaging Het
Kcnt2 T C 1: 140,512,908 L624S probably benign Het
Mdga2 A G 12: 66,550,561 Y720H probably damaging Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Msl2 T C 9: 101,100,843 F139L probably benign Het
Nuggc T C 14: 65,608,856 V72A probably benign Het
Olfr826 A T 10: 130,180,769 V37E possibly damaging Het
Pde2a T A 7: 101,510,313 Y783* probably null Het
Pfkfb2 A G 1: 130,700,796 Y358H probably damaging Het
Pou2f1 A G 1: 165,931,689 S23P probably damaging Het
Prrc2a T C 17: 35,159,501 probably null Het
Prss36 T C 7: 127,945,238 T92A probably benign Het
Rnft2 A G 5: 118,194,570 probably benign Het
Sbno2 A G 10: 80,060,034 V971A possibly damaging Het
Sec63 A G 10: 42,783,442 E42G probably damaging Het
Setdb2 A T 14: 59,415,740 L371Q probably damaging Het
Shprh A T 10: 11,166,693 I807F probably damaging Het
Slc3a2 T C 19: 8,709,610 probably null Het
Srbd1 T C 17: 86,099,290 I556V possibly damaging Het
Stim2 T A 5: 54,118,299 C605* probably null Het
Tecrl T C 5: 83,354,802 T67A possibly damaging Het
Ttc33 C A 15: 5,212,042 A116E probably damaging Het
Ttn G A 2: 76,942,049 T2503I possibly damaging Het
Ubp1 T C 9: 113,972,763 I468T probably damaging Het
Urgcp A T 11: 5,718,115 H74Q probably benign Het
Vcan A G 13: 89,678,133 I2224T probably damaging Het
Vmn1r8 T A 6: 57,036,415 N150K probably damaging Het
Vmn2r3 A G 3: 64,259,247 M821T probably damaging Het
Zfp777 C A 6: 48,024,691 A866S probably damaging Het
Other mutations in C1qtnf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:C1qtnf7 APN 5 43609260 missense possibly damaging 0.92
IGL01411:C1qtnf7 APN 5 43609061 start codon destroyed probably benign 0.01
R1464:C1qtnf7 UTSW 5 43609139 missense probably benign 0.18
R1464:C1qtnf7 UTSW 5 43609139 missense probably benign 0.18
R1630:C1qtnf7 UTSW 5 43609161 missense possibly damaging 0.73
R2883:C1qtnf7 UTSW 5 43615880 missense probably damaging 1.00
R4441:C1qtnf7 UTSW 5 43609270 missense possibly damaging 0.85
R4569:C1qtnf7 UTSW 5 43609207 missense possibly damaging 0.85
R5101:C1qtnf7 UTSW 5 43615972 nonsense probably null
R5180:C1qtnf7 UTSW 5 43615814 missense probably benign 0.19
R5596:C1qtnf7 UTSW 5 43515970 start gained probably benign
R5886:C1qtnf7 UTSW 5 43615656 missense probably damaging 1.00
R5997:C1qtnf7 UTSW 5 43616085 missense probably damaging 1.00
R6830:C1qtnf7 UTSW 5 43609094 missense possibly damaging 0.53
R7615:C1qtnf7 UTSW 5 43616144 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATGTGTAAGGCAATGAGG -3'
(R):5'- CTCTACCATCCCTTCCAGGAAG -3'

Sequencing Primer
(F):5'- CAATGAGGATTCTGTCAACAGTG -3'
(R):5'- TTCCAGGAAGGCCAATGC -3'
Posted On2019-06-10