Mutagenetix > Incidental Mutation

Incidental Mutation 'R6949:Kcp'

557072

Institutional Source

Beutler Lab

Gene Symbol

Kcp

Ensembl Gene

ENSMUSG00000059022

Gene Name

kielin/chordin-like protein

Synonyms

Crim2, KCP, LOC333088

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R6949 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29473162-29507952 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to A at 29484612 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479]

AlphaFold

Q3U492

Predicted Effect

probably null
Transcript: ENSMUST00000078112

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000091391

SMART Domains

Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1082	6.53e-9	SMART
VWC	1089	1142	1.05e-3	SMART
VWC	1149	1206	2.93e-11	SMART
Pfam:VWD	1213	1253	4.6e-11	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000101614

SMART Domains

Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	8e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
VWD	1201	1362	6.09e-50	SMART
C8	1404	1479	1.55e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159479

SMART Domains

Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
VWC	1	51	4.56e-1	SMART
VWC	54	110	1.98e-8	SMART
VWC	113	169	1.35e-1	SMART
VWC	172	228	5.77e-10	SMART
VWC	231	286	1.21e-3	SMART
VWC	289	353	6.53e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161276

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.8%
20x: 95.1%

Validation Efficiency

100% (45/45)

MGI Phenotype

PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank2	G	T	3: 127,010,884	D679E	probably benign	Het
Catsper4	A	T	4: 134,225,747	Y96N	probably benign	Het
Cnksr3	T	C	10: 7,160,757	I35V	probably benign	Het
Col16a1	A	G	4: 130,059,323	E424G	probably damaging	Het
Ctsc	G	T	7: 88,281,458	G82W	probably damaging	Het
Cxcr4	T	C	1: 128,589,615	D101G	probably benign	Het
Dapk1	T	A	13: 60,736,324	N635K	probably benign	Het
Dopey1	T	C	9: 86,500,860	M282T	probably damaging	Het
Dpysl4	G	A	7: 139,091,999	E172K	probably damaging	Het
Eif2ak3	T	C	6: 70,878,845	I211T	probably damaging	Het
Fam71f1	T	A	6: 29,323,906	I210N	probably damaging	Het
Fbxw22	A	T	9: 109,382,076	W386R	probably benign	Het
Gm11639	A	C	11: 104,909,070	T2931P	probably damaging	Het
Grm7	A	G	6: 110,646,304	K146R	probably benign	Het
Grm7	C	A	6: 111,495,729	P843Q	probably damaging	Het
Gtf2e2	A	G	8: 33,758,698	D171G	probably damaging	Het
Hyal5	T	C	6: 24,876,304	S59P	probably benign	Het
Il7r	T	A	15: 9,508,004	T411S	probably damaging	Het
Krcc1	T	C	6: 71,284,151	Y56H	probably benign	Het
Lmo2	T	A	2: 103,970,673	M1K	probably null	Het
Lrit3	G	A	3: 129,789,285	T351I	probably damaging	Het
Mcu	T	G	10: 59,456,744	T38P	possibly damaging	Het
Mylk	T	A	16: 35,000,318	I89N	probably damaging	Het
Ncoa2	A	T	1: 13,156,501	C996S	possibly damaging	Het
Npr2	A	G	4: 43,640,597	E350G	probably damaging	Het
Olfr1437	T	C	19: 12,322,428	Y133C	probably damaging	Het
Pald1	T	C	10: 61,321,217	E818G	probably benign	Het
Phf19	G	T	2: 34,904,131	Q210K	probably damaging	Het
Pomgnt1	G	A	4: 116,154,154	V250M	probably damaging	Het
Ppm1l	T	A	3: 69,549,403	C218S	possibly damaging	Het
Prkdc	G	A	16: 15,799,989	R3228H	probably benign	Het
Pros1	A	T	16: 62,924,575	T518S	probably benign	Het
Rdh8	T	A	9: 20,822,707	V63D	probably benign	Het
Rexo1	A	G	10: 80,550,636	V196A	possibly damaging	Het
Scgb2b20	A	T	7: 33,366,299	M1K	probably null	Het
Scn11a	A	G	9: 119,765,514	V1271A	probably benign	Het
Serac1	C	A	17: 6,051,815	D395Y	probably damaging	Het
Syne2	A	G	12: 75,965,997	D2655G	probably benign	Het
Tm4sf19	T	C	16: 32,405,858	V8A	probably benign	Het
Usp3	A	T	9: 66,520,690	D334E	probably benign	Het
Uty	C	T	Y: 1,240,000		probably null	Het
Vmn2r7	T	C	3: 64,691,121	N672D	probably damaging	Het
Vmn2r96	T	A	17: 18,597,838	L751H	probably damaging	Het
Wnk2	T	C	13: 49,101,140	S300G	probably damaging	Het
Zp3r	G	T	1: 130,577,895	S508R	probably benign	Het

Other mutations in Kcp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Kcp	APN	6	29482657	missense	probably benign
IGL01344:Kcp	APN	6	29498951	splice site	probably null
IGL01404:Kcp	APN	6	29496639	missense	probably damaging	0.99
IGL01735:Kcp	APN	6	29498879	missense	probably damaging	1.00
IGL01776:Kcp	APN	6	29497908	missense	probably damaging	1.00
IGL02092:Kcp	APN	6	29489032	critical splice donor site	probably null
IGL02252:Kcp	APN	6	29504549	missense	probably damaging	1.00
IGL02690:Kcp	APN	6	29484999	unclassified	probably benign
IGL02817:Kcp	APN	6	29496969	missense	probably damaging	0.97
IGL03074:Kcp	APN	6	29496631	missense	probably damaging	1.00
P0045:Kcp	UTSW	6	29498348	missense	probably damaging	1.00
R0219:Kcp	UTSW	6	29495785	missense	probably damaging	1.00
R0355:Kcp	UTSW	6	29496927	missense	possibly damaging	0.89
R0738:Kcp	UTSW	6	29490439	missense	probably benign	0.24
R1111:Kcp	UTSW	6	29485423	missense	probably benign
R1304:Kcp	UTSW	6	29501292	unclassified	probably benign
R1663:Kcp	UTSW	6	29498965	missense	possibly damaging	0.68
R1808:Kcp	UTSW	6	29505655	missense	probably benign	0.05
R1907:Kcp	UTSW	6	29497835	unclassified	probably benign
R2030:Kcp	UTSW	6	29489072	missense	probably damaging	1.00
R2099:Kcp	UTSW	6	29496165	nonsense	probably null
R3411:Kcp	UTSW	6	29482846	missense	possibly damaging	0.68
R3982:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R3983:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R4223:Kcp	UTSW	6	29482258	missense	possibly damaging	0.55
R4377:Kcp	UTSW	6	29493203	missense	probably damaging	1.00
R4570:Kcp	UTSW	6	29491848	nonsense	probably null
R4624:Kcp	UTSW	6	29482814	missense	possibly damaging	0.94
R4694:Kcp	UTSW	6	29493197	missense	probably benign	0.29
R4750:Kcp	UTSW	6	29484626	missense	probably benign	0.03
R4968:Kcp	UTSW	6	29497629	nonsense	probably null
R5053:Kcp	UTSW	6	29496958	missense	probably benign	0.01
R5067:Kcp	UTSW	6	29492108	missense	probably benign	0.06
R5253:Kcp	UTSW	6	29498520	unclassified	probably benign
R5418:Kcp	UTSW	6	29504284	nonsense	probably null
R6020:Kcp	UTSW	6	29502864	missense	probably benign	0.03
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6088:Kcp	UTSW	6	29502632	missense	probably benign
R6178:Kcp	UTSW	6	29482888	missense	possibly damaging	0.68
R6285:Kcp	UTSW	6	29502365	missense	probably benign	0.21
R6310:Kcp	UTSW	6	29493258	missense	probably damaging	0.98
R6369:Kcp	UTSW	6	29484694	missense	probably damaging	1.00
R6860:Kcp	UTSW	6	29505720	missense	probably benign	0.19
R6962:Kcp	UTSW	6	29482840	missense	probably benign	0.08
R7006:Kcp	UTSW	6	29499170	missense	probably damaging	1.00
R7138:Kcp	UTSW	6	29491862	nonsense	probably null
R7141:Kcp	UTSW	6	29487512	nonsense	probably null
R7153:Kcp	UTSW	6	29499015	missense	probably damaging	1.00
R7162:Kcp	UTSW	6	29497200	splice site	probably null
R7334:Kcp	UTSW	6	29485512	missense	probably damaging	1.00
R7565:Kcp	UTSW	6	29499187	missense	probably damaging	1.00
R7671:Kcp	UTSW	6	29496517	missense	probably benign	0.02
R7766:Kcp	UTSW	6	29496847	missense	probably damaging	0.98
R7781:Kcp	UTSW	6	29497765	missense	probably damaging	1.00
R8702:Kcp	UTSW	6	29482751	missense	probably damaging	1.00
R9384:Kcp	UTSW	6	29496619	critical splice donor site	probably null
R9425:Kcp	UTSW	6	29489152	missense	probably benign
R9553:Kcp	UTSW	6	29485101	missense	probably null	1.00
R9752:Kcp	UTSW	6	29497755	missense	probably damaging	1.00
R9755:Kcp	UTSW	6	29492461	missense	probably damaging	1.00
Z1176:Kcp	UTSW	6	29485012	missense	probably benign	0.23
Z1177:Kcp	UTSW	6	29485525	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- ACACAGCTTGGGGTTGTAAG -3'
(R):5'- TCAGTGCTACACAGTTCACC -3'

Sequencing Primer
(F):5'- CTGCGAGCAAGAGATCATCATTTTCC -3'
(R):5'- ACCTGTCTGATCCGACATGG -3'

Posted On

2019-06-10