Incidental Mutation 'R6925:Ngef'
ID557081
Institutional Source Beutler Lab
Gene Symbol Ngef
Ensembl Gene ENSMUSG00000026259
Gene Nameneuronal guanine nucleotide exchange factor
SynonymsTims2, ephexin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6925 (G1)
Quality Score93.0077
Status Validated
Chromosome1
Chromosomal Location87476834-87573870 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to G at 87503263 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027477] [ENSMUST00000068681]
Predicted Effect probably null
Transcript: ENSMUST00000027477
SMART Domains Protein: ENSMUSP00000027477
Gene: ENSMUSG00000026259

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
low complexity region 15 28 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
RhoGEF 187 366 8.16e-46 SMART
PH 400 513 1.2e-7 SMART
SH3 525 582 8.43e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000068681
SMART Domains Protein: ENSMUSP00000066894
Gene: ENSMUSG00000026259

DomainStartEndE-ValueType
low complexity region 213 226 N/A INTRINSIC
RhoGEF 277 456 8.16e-46 SMART
PH 490 603 1.2e-7 SMART
SH3 615 672 8.43e-15 SMART
Meta Mutation Damage Score 0.672 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (91/91)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show no overt axonal phenotype; however, cultured retinal ganglion cells display defects in axonal outgrowth and ephrin-induced growth cone collapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,222,707 Q177R possibly damaging Het
Acat1 A T 9: 53,592,029 V170E probably benign Het
Atp2b2 T A 6: 113,760,720 I902F probably damaging Het
Cacna1d A G 14: 30,051,637 V1697A probably benign Het
Ccdc14 T A 16: 34,690,749 F31Y probably benign Het
Ccdc17 T A 4: 116,598,210 V250E probably damaging Het
Cct7 A G 6: 85,459,182 N25S probably damaging Het
Cep19 G C 16: 32,103,942 G9R probably damaging Het
Ces5a A T 8: 93,523,057 probably null Het
Chd1l T G 3: 97,582,826 E471A probably damaging Het
Chd6 A G 2: 161,013,127 I787T probably damaging Het
Cntnap5c A C 17: 58,395,266 T1194P probably benign Het
Col6a3 T A 1: 90,816,002 M208L probably benign Het
Coro7 A T 16: 4,628,674 probably null Het
Csrnp2 T C 15: 100,481,958 K484R probably benign Het
Cyp2c39 T A 19: 39,513,195 V64E probably damaging Het
Ddr2 T C 1: 169,998,132 K300E probably benign Het
Ddx56 T C 11: 6,263,980 E393G probably damaging Het
Diaph1 A C 18: 37,853,679 Y1084* probably null Het
Disp1 A T 1: 183,086,478 F1459L probably benign Het
Dnajc8 G A 4: 132,544,113 A80T probably damaging Het
Elfn1 T A 5: 139,971,685 M148K probably benign Het
Emcn T A 3: 137,419,002 I154N probably damaging Het
Enah C G 1: 181,905,898 probably null Het
Enah T A 1: 181,905,899 probably null Het
Ep300 C A 15: 81,649,981 Q2080K probably benign Het
Epha2 T A 4: 141,308,757 M168K probably benign Het
Ercc6 T A 14: 32,562,608 I776N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat4 G T 3: 38,996,204 probably null Het
G3bp1 A G 11: 55,497,960 R333G possibly damaging Het
Gm3604 A G 13: 62,369,390 F385L probably benign Het
Gm5800 T C 14: 51,713,700 I147M possibly damaging Het
Hipk1 A G 3: 103,778,245 F18S unknown Het
Ighv3-8 A T 12: 114,322,330 C131S probably benign Het
Il23r T G 6: 67,423,493 T618P probably damaging Het
Il31ra G A 13: 112,527,529 T538I possibly damaging Het
Kcns2 A G 15: 34,839,913 D474G unknown Het
Klc4 T C 17: 46,636,229 T407A possibly damaging Het
Klra5 C T 6: 129,911,457 S2N probably benign Het
Krt10 T C 11: 99,388,851 Y161C probably damaging Het
Kxd1 A T 8: 70,523,278 M1K probably null Het
Lgals1 A C 15: 78,928,040 D27A possibly damaging Het
Lgr5 T C 10: 115,466,346 S308G probably benign Het
Lrp1 G A 10: 127,556,988 S2736L probably benign Het
Lrpap1 G T 5: 35,102,536 H73N probably benign Het
Mcpt1 C A 14: 56,019,065 T86K probably damaging Het
Megf6 A T 4: 154,254,587 D527V probably damaging Het
Mical3 A T 6: 120,959,390 S1392T probably benign Het
Mmp2 A T 8: 92,839,382 D437V probably damaging Het
Mob4 T A 1: 55,152,722 Y166* probably null Het
Mrap2 G A 9: 87,182,474 M89I possibly damaging Het
Mug1 G A 6: 121,881,787 A1155T probably damaging Het
Myh2 G T 11: 67,193,218 A1556S probably benign Het
Nfatc3 A G 8: 106,119,322 D1028G probably benign Het
Nlrp1a A T 11: 71,092,513 L1209Q probably null Het
Npr2 C T 4: 43,647,553 R819C probably damaging Het
Nsd2 A T 5: 33,879,110 D646V probably damaging Het
Nsun7 A G 5: 66,277,072 H252R probably damaging Het
Olfr267 A T 4: 58,785,647 I25N possibly damaging Het
Olfr447 T A 6: 42,911,857 C111* probably null Het
Olfr642 C T 7: 104,049,740 V205I probably benign Het
Olfr951 A T 9: 39,393,860 Q20L probably benign Het
Olfr951 G T 9: 39,393,861 Q20H probably benign Het
Pcdhga2 A T 18: 37,670,585 D494V probably damaging Het
Pcsk2 A G 2: 143,813,747 E617G probably damaging Het
Pdc T C 1: 150,333,180 I138T probably damaging Het
Phc2 T A 4: 128,748,134 S750T probably damaging Het
Pkd2l1 T A 19: 44,191,508 N88Y possibly damaging Het
Plcl1 C T 1: 55,406,598 R71* probably null Het
Prag1 C A 8: 36,103,894 L544M probably damaging Het
Prkg2 A G 5: 98,966,510 probably null Het
Psd2 G A 18: 35,979,711 S153N probably damaging Het
Rab11fip1 A T 8: 27,152,972 S600T probably damaging Het
Rbms1 T G 2: 60,762,304 T222P probably benign Het
Slfn8 A T 11: 83,013,417 Y382* probably null Het
Socs4 T A 14: 47,289,738 C43* probably null Het
Sorl1 T A 9: 42,033,626 T868S probably damaging Het
St6gal1 A G 16: 23,356,213 Y267C probably damaging Het
Syne1 A G 10: 5,126,682 V6879A probably benign Het
Syne2 C A 12: 75,854,132 H22N possibly damaging Het
Tmeff2 T A 1: 50,928,021 L25Q probably damaging Het
Tmprss11g G T 5: 86,487,426 D396E probably benign Het
Tmprss11g T A 5: 86,487,436 H393L probably benign Het
Vmn2r23 A G 6: 123,704,553 E140G probably damaging Het
Wapl T C 14: 34,677,363 S130P probably benign Het
Zeb2 T A 2: 44,994,529 K982M probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp719 T C 7: 43,590,706 S573P probably damaging Het
Zfp979 A T 4: 147,613,542 C237S possibly damaging Het
Other mutations in Ngef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02221:Ngef APN 1 87540696 missense probably benign 0.06
IGL02475:Ngef APN 1 87479150 missense possibly damaging 0.79
IGL02478:Ngef APN 1 87480579 splice site probably benign
IGL03002:Ngef APN 1 87509392 splice site probably null
H8562:Ngef UTSW 1 87487807 missense possibly damaging 0.84
R0078:Ngef UTSW 1 87540665 missense probably benign 0.12
R0145:Ngef UTSW 1 87540648 intron probably benign
R0193:Ngef UTSW 1 87509334 missense probably benign 0.03
R0244:Ngef UTSW 1 87487962 unclassified probably benign
R0486:Ngef UTSW 1 87479126 missense probably damaging 1.00
R0865:Ngef UTSW 1 87484601 missense probably benign
R1824:Ngef UTSW 1 87503264 critical splice donor site probably null
R1994:Ngef UTSW 1 87487904 missense probably damaging 1.00
R2020:Ngef UTSW 1 87545968 missense probably benign 0.43
R4059:Ngef UTSW 1 87486231 missense probably damaging 0.99
R4770:Ngef UTSW 1 87477561 missense probably damaging 1.00
R4959:Ngef UTSW 1 87503348 missense possibly damaging 0.68
R5197:Ngef UTSW 1 87509368 nonsense probably null
R5286:Ngef UTSW 1 87545830 missense probably benign
R5293:Ngef UTSW 1 87503429 small deletion probably benign
R6065:Ngef UTSW 1 87477648 missense probably damaging 1.00
R6192:Ngef UTSW 1 87487900 missense probably damaging 0.98
R7176:Ngef UTSW 1 87480695 missense possibly damaging 0.94
R7437:Ngef UTSW 1 87480605 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAATCAGCCCAGAAAGTGGC -3'
(R):5'- CTCTCCAAGAAATTGAAACACGGAG -3'

Sequencing Primer
(F):5'- CAGAAAGTGGCTGGGTGGTC -3'
(R):5'- AACTCCGATGGGTCCCAG -3'
Posted On2019-06-10