Incidental Mutation 'R6967:Adam23'
ID557093
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6967 (G1)
Quality Score160.009
Status Validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 63563336 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect probably null
Transcript: ENSMUST00000087374
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114103
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114107
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik A G 7: 104,059,005 I199T probably benign Het
6430628N08Rik A G 4: 115,898,294 T97A unknown Het
Adamts8 C T 9: 30,954,491 T445I probably benign Het
Ahi1 T C 10: 20,988,625 V752A probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Bicra T C 7: 15,972,205 E1437G probably damaging Het
Cdc42ep4 C T 11: 113,729,172 S131N possibly damaging Het
Ces1f G A 8: 93,267,997 P262L probably benign Het
Chrna2 A T 14: 66,150,949 probably null Het
Cspg4 G A 9: 56,890,136 V1295M possibly damaging Het
D5Ertd579e T C 5: 36,615,756 T432A probably benign Het
Dach1 A T 14: 97,903,197 S456R probably damaging Het
Dhx37 T C 5: 125,422,167 D659G probably benign Het
Dscaml1 T C 9: 45,674,523 V586A probably damaging Het
Efhb G T 17: 53,463,168 L38I probably benign Het
Fam208b A T 13: 3,574,819 D1710E probably benign Het
Fbxw10 T C 11: 62,847,603 S108P possibly damaging Het
Fmnl2 A G 2: 53,097,332 N313S possibly damaging Het
Gga3 T C 11: 115,591,276 E172G probably damaging Het
Ggta1 A G 2: 35,402,722 V191A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hcn4 C T 9: 58,823,945 T145M unknown Het
Kirrel3 T C 9: 35,034,906 S654P probably damaging Het
Klrb1 A T 6: 128,710,523 probably null Het
Krt15 T A 11: 100,134,513 D166V probably damaging Het
Lipk T A 19: 34,040,394 Y277* probably null Het
Ly6g A C 15: 75,158,549 N49T possibly damaging Het
Ms4a4c A T 19: 11,414,827 Q4L probably benign Het
Nfya A C 17: 48,392,904 probably benign Het
Nub1 T C 5: 24,708,711 V530A probably benign Het
Ocln A T 13: 100,539,288 Y232* probably null Het
Olfr1129 A G 2: 87,575,513 N143S possibly damaging Het
Olfr1468-ps1 A G 19: 13,375,451 H163R unknown Het
Olfr456 A G 6: 42,487,013 F60S probably damaging Het
Olfr462 C T 11: 87,889,498 V133I probably benign Het
Otogl G A 10: 107,814,050 A1148V probably benign Het
Paqr5 C T 9: 61,972,831 W46* probably null Het
Psd2 C A 18: 35,980,332 L286M probably damaging Het
Ptpn4 A T 1: 119,684,581 Y27* probably null Het
Ripk2 A G 4: 16,158,275 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sbk2 C T 7: 4,964,147 probably null Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sspo A C 6: 48,489,794 D4072A probably benign Het
St6galnac3 T C 3: 153,206,708 Y214C probably damaging Het
Sugp1 T A 8: 70,060,552 D256E possibly damaging Het
Sugt1 A G 14: 79,597,407 Y90C probably benign Het
Taok2 A G 7: 126,870,392 I1088T probably damaging Het
Tmc7 T A 7: 118,547,678 T459S probably benign Het
Tmed11 T C 5: 108,778,914 Y164C probably damaging Het
Tmem63b T C 17: 45,666,632 E356G probably benign Het
Ttc13 T C 8: 124,688,618 I261V probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn1r73 A T 7: 11,756,617 K121* probably null Het
Zc3h12d A T 10: 7,839,880 S16C probably damaging Het
Zfp292 A T 4: 34,807,812 M1744K probably damaging Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
BB007:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
BB017:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1755:Adam23 UTSW 1 63543170 missense probably damaging 1.00
R1813:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1858:Adam23 UTSW 1 63557456 missense probably benign 0.12
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2249:Adam23 UTSW 1 63535176 nonsense probably null
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3974:Adam23 UTSW 1 63547729 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4066:Adam23 UTSW 1 63563425 missense probably damaging 1.00
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4383:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
R7584:Adam23 UTSW 1 63545462 missense probably damaging 1.00
R7930:Adam23 UTSW 1 63585427 missense possibly damaging 0.89
R8261:Adam23 UTSW 1 63528798 missense noncoding transcript
R8425:Adam23 UTSW 1 63585377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCCCTTCTGCTTGTAGC -3'
(R):5'- CCCAAGTTACATGTATGGAAAGTGG -3'

Sequencing Primer
(F):5'- GCTTGTAGCTCCTTGACAAATG -3'
(R):5'- TGGGGGAAATGACACTAATCCCTTC -3'
Posted On2019-06-14