Incidental Mutation 'R7032:Atp8a2'
ID557109
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R7032 (G1)
Quality Score214.009
Status Validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 60017840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
Predicted Effect probably null
Transcript: ENSMUST00000080368
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T G 8: 45,956,437 S282R probably damaging Het
2310003L06Rik T A 5: 87,972,579 D398E possibly damaging Het
Adam34 T C 8: 43,652,266 Y114C probably damaging Het
Akap9 T A 5: 3,954,896 D156E probably benign Het
Apba1 T A 19: 23,912,461 S408T probably benign Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atf6 A T 1: 170,799,612 probably null Het
Atp6v1b2 T A 8: 69,088,896 V35E probably benign Het
Ccdc170 C A 10: 4,482,597 P12Q unknown Het
Cdh23 C T 10: 60,331,788 E1810K probably damaging Het
Cdo1 A T 18: 46,720,408 F94L probably damaging Het
Chdh C T 14: 30,036,852 P585S possibly damaging Het
Clasp2 A G 9: 113,854,323 N407S probably benign Het
Clca3a1 T A 3: 144,747,568 S465C probably benign Het
Clip2 C A 5: 134,522,630 V213L probably damaging Het
Col6a6 A G 9: 105,767,508 S1194P probably damaging Het
Cyp7a1 T C 4: 6,268,463 T421A possibly damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dnah5 A G 15: 28,326,650 N2002D probably damaging Het
Epn2 T A 11: 61,546,702 N15Y probably damaging Het
Evi5 A C 5: 107,788,281 V647G probably benign Het
Eya1 T C 1: 14,283,200 probably null Het
Fam120a A G 13: 48,949,113 V222A probably benign Het
Fastkd5 A T 2: 130,615,944 I242K possibly damaging Het
Hnrnpul1 A G 7: 25,750,894 M131T probably benign Het
Ice1 T C 13: 70,596,164 N2100S probably damaging Het
Ifi205 T A 1: 174,028,350 D38V possibly damaging Het
Klhl9 G A 4: 88,721,606 Q133* probably null Het
Krt84 T C 15: 101,528,489 E370G probably benign Het
Lrrc4c T C 2: 97,629,065 I12T probably benign Het
Lrriq4 T A 3: 30,655,701 L398* probably null Het
Ltf G A 9: 111,026,130 probably null Het
Macf1 C T 4: 123,472,308 V1322I probably benign Het
Mark2 T A 19: 7,287,333 I112L probably damaging Het
Mterf2 A T 10: 85,120,663 C32* probably null Het
Myo3b C T 2: 70,095,264 T25I probably damaging Het
Nsun7 A C 5: 66,264,035 I115L probably benign Het
Olfm3 G A 3: 115,090,156 V36M probably damaging Het
Olfr1174-ps T C 2: 88,311,029 T256A probably benign Het
Olfr147 A T 9: 38,403,669 Y262F possibly damaging Het
Olfr1537 A T 9: 39,237,687 S246T possibly damaging Het
Olfr406 T C 11: 74,269,602 I71T possibly damaging Het
Pcdhgb8 A T 18: 37,763,909 R677S probably benign Het
Prrt4 A C 6: 29,170,539 L638R possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab44 T C 17: 29,140,464 F542S unknown Het
Rhobtb3 T A 13: 75,872,394 E596D probably benign Het
Rpl36 T C 17: 56,613,944 I44T probably benign Het
Rptor A G 11: 119,846,936 I112V probably benign Het
Rrnad1 A G 3: 87,924,342 probably null Het
Rxfp2 T C 5: 150,070,348 I611T probably damaging Het
Slc12a4 G T 8: 105,949,233 N553K probably damaging Het
Spata31d1d T A 13: 59,728,232 R496S probably benign Het
Strbp T C 2: 37,603,113 D387G possibly damaging Het
Tas2r107 A T 6: 131,659,190 C299S possibly damaging Het
Tbc1d21 A T 9: 58,366,851 probably null Het
Tdrd12 A T 7: 35,481,046 Y847* probably null Het
Tlr2 A T 3: 83,837,905 N290K probably benign Het
Tmppe A G 9: 114,405,790 T386A probably damaging Het
Tnks1bp1 C A 2: 85,061,953 H741Q probably benign Het
Trpc6 G A 9: 8,609,950 V140M probably damaging Het
Ttn T C 2: 76,811,588 D13427G probably damaging Het
Uba7 C A 9: 107,976,172 L106I possibly damaging Het
Unc5b T G 10: 60,778,808 T237P probably damaging Het
Vit A C 17: 78,624,865 D467A probably damaging Het
Vmn1r103 T C 7: 20,509,855 Y227C possibly damaging Het
Vmn1r77 T A 7: 12,042,090 Y196* probably null Het
Zhx3 A G 2: 160,780,978 V423A probably damaging Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
PIT4431001:Atp8a2 UTSW 14 59654626 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 59860212 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1387:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1426:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1442:Atp8a2 UTSW 14 59860323 splice site probably benign
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1937:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59691465 frame shift probably null
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60026140 critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60046722 missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
R7243:Atp8a2 UTSW 14 59647842 missense probably benign
R7352:Atp8a2 UTSW 14 59791204 missense probably benign
R7355:Atp8a2 UTSW 14 60045004 missense possibly damaging 0.65
R7382:Atp8a2 UTSW 14 59654594 missense probably benign 0.00
R7451:Atp8a2 UTSW 14 59791181 missense probably null 0.00
R7483:Atp8a2 UTSW 14 60008375 missense probably benign 0.00
R7516:Atp8a2 UTSW 14 59857067 missense probably damaging 1.00
R7831:Atp8a2 UTSW 14 59773753 missense probably damaging 0.99
R8116:Atp8a2 UTSW 14 60026208 missense probably damaging 1.00
R8171:Atp8a2 UTSW 14 60046044 missense probably damaging 1.00
R8504:Atp8a2 UTSW 14 59647917 nonsense probably null
R8516:Atp8a2 UTSW 14 59691472 missense probably benign 0.00
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Z1177:Atp8a2 UTSW 14 60006330 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCAGTAAGACACAGTTAGCCAG -3'
(R):5'- GTTTGAAGACCAGAGTGTCAGG -3'

Sequencing Primer
(F):5'- GTCACCCAGACTTGTAATGCG -3'
(R):5'- ATGGAGCAGTATTCTCAGCC -3'
Posted On2019-06-21