Incidental Mutation 'R0585:Olfr665'
ID55712
Institutional Source Beutler Lab
Gene Symbol Olfr665
Ensembl Gene ENSMUSG00000073917
Gene Nameolfactory receptor 665
SynonymsGA_x6K02T2PBJ9-7509539-7510489, MOR34-7
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0585 (G1)
Quality Score194
Status Validated
Chromosome7
Chromosomal Location104878031-104882906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104881499 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 264 (H264P)
Ref Sequence ENSEMBL: ENSMUSP00000150229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098165] [ENSMUST00000215761] [ENSMUST00000216257] [ENSMUST00000216971]
Predicted Effect probably damaging
Transcript: ENSMUST00000098165
AA Change: H264P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095768
Gene: ENSMUSG00000073917
AA Change: H264P

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 6.4e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1e-5 PFAM
Pfam:7tm_1 43 295 1.4e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215761
AA Change: H264P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216257
AA Change: H264P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216971
AA Change: H264P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Olfr665
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Olfr665 APN 7 104881517 missense probably benign 0.01
IGL01408:Olfr665 APN 7 104880830 missense probably benign 0.02
IGL02022:Olfr665 APN 7 104880934 missense probably damaging 1.00
R0349:Olfr665 UTSW 7 104880992 missense possibly damaging 0.48
R1518:Olfr665 UTSW 7 104881308 nonsense probably null
R1659:Olfr665 UTSW 7 104881180 missense probably benign 0.00
R1727:Olfr665 UTSW 7 104881514 missense probably benign 0.11
R1762:Olfr665 UTSW 7 104881240 missense probably damaging 0.99
R4052:Olfr665 UTSW 7 104881603 missense probably damaging 0.99
R4208:Olfr665 UTSW 7 104881603 missense probably damaging 0.99
R5486:Olfr665 UTSW 7 104880961 missense probably benign 0.02
R5513:Olfr665 UTSW 7 104881499 missense probably damaging 1.00
R6148:Olfr665 UTSW 7 104881082 missense possibly damaging 0.84
R6593:Olfr665 UTSW 7 104881433 missense probably damaging 1.00
R7143:Olfr665 UTSW 7 104881186 missense probably damaging 1.00
R7189:Olfr665 UTSW 7 104881141 nonsense probably null
R7413:Olfr665 UTSW 7 104880850 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCGTCTTCCATACTGTAGAGGAAACC -3'
(R):5'- GCCTAAGAATATGTGCTTGGATCAGCC -3'

Sequencing Primer
(F):5'- TTCCATACTGTAGAGGAAACCTCATC -3'
(R):5'- CTTGGATCAGCCAGGGTTTAC -3'
Posted On2013-07-11