Incidental Mutation 'R0585:Ces2e'
ID55714
Institutional Source Beutler Lab
Gene Symbol Ces2e
Ensembl Gene ENSMUSG00000031886
Gene Namecarboxylesterase 2E
Synonyms9030624L02Rik, Ces5
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0585 (G1)
Quality Score148
Status Validated
Chromosome8
Chromosomal Location104926260-104934672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104929821 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 228 (S228P)
Ref Sequence ENSEMBL: ENSMUSP00000105037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034355] [ENSMUST00000109410]
Predicted Effect probably damaging
Transcript: ENSMUST00000034355
AA Change: S228P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034355
Gene: ENSMUSG00000031886
AA Change: S228P

DomainStartEndE-ValueType
Pfam:COesterase 11 538 1.2e-174 PFAM
Pfam:Abhydrolase_3 143 252 4.6e-11 PFAM
Pfam:Peptidase_S9 159 296 2.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109410
AA Change: S228P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105037
Gene: ENSMUSG00000031886
AA Change: S228P

DomainStartEndE-ValueType
Pfam:COesterase 9 538 1.7e-171 PFAM
Pfam:Abhydrolase_3 143 246 6.6e-11 PFAM
Pfam:Peptidase_S9 158 276 2.1e-7 PFAM
Meta Mutation Damage Score 0.4800 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Ces2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Ces2e APN 8 104929565 missense probably benign 0.42
IGL02045:Ces2e APN 8 104930658 splice site probably benign
IGL02656:Ces2e APN 8 104927056 missense possibly damaging 0.94
IGL02904:Ces2e APN 8 104931338 missense probably benign
IGL02972:Ces2e APN 8 104927061 missense probably damaging 1.00
IGL03244:Ces2e APN 8 104928819 missense probably benign 0.38
R0762:Ces2e UTSW 8 104929864 missense probably damaging 0.98
R1004:Ces2e UTSW 8 104929738 missense probably damaging 1.00
R1168:Ces2e UTSW 8 104927014 missense possibly damaging 0.49
R1731:Ces2e UTSW 8 104929576 missense probably damaging 1.00
R2134:Ces2e UTSW 8 104932539 critical splice donor site probably null
R3087:Ces2e UTSW 8 104930715 missense probably benign 0.18
R3693:Ces2e UTSW 8 104928811 missense probably damaging 1.00
R4622:Ces2e UTSW 8 104928709 intron probably null
R4873:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4875:Ces2e UTSW 8 104927185 missense probably damaging 1.00
R4965:Ces2e UTSW 8 104933698 missense probably benign 0.09
R5365:Ces2e UTSW 8 104927214 critical splice donor site probably null
R5529:Ces2e UTSW 8 104929911 missense probably benign 0.00
R5601:Ces2e UTSW 8 104929494 missense probably benign 0.42
R5968:Ces2e UTSW 8 104932995 missense probably damaging 1.00
R6128:Ces2e UTSW 8 104928796 missense probably benign 0.03
R7337:Ces2e UTSW 8 104931056 splice site probably null
R7363:Ces2e UTSW 8 104933000 splice site probably null
R7489:Ces2e UTSW 8 104929780 missense probably benign 0.26
R7548:Ces2e UTSW 8 104931906 missense probably benign
R8068:Ces2e UTSW 8 104932997 critical splice donor site probably null
Z1088:Ces2e UTSW 8 104931347 missense probably benign
Z1088:Ces2e UTSW 8 104932398 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCACTCACTGTTGGCATGGCTTC -3'
(R):5'- TGAACACAGTACCAGCGAACTAGGG -3'

Sequencing Primer
(F):5'- TTTGGCAATGTGGAATGATCAGAAC -3'
(R):5'- TGAGTGCTAAGACAGTAGGTCG -3'
Posted On2013-07-11