Incidental Mutation 'R7154:Gimap8'
ID557140
Institutional Source Beutler Lab
Gene Symbol Gimap8
Ensembl Gene ENSMUSG00000064262
Gene NameGTPase, IMAP family member 8
SynonymsIAN9, LOC243374
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7154 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48647234-48660875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48656188 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 314 (F314I)
Ref Sequence ENSEMBL: ENSMUSP00000145286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078223] [ENSMUST00000203083] [ENSMUST00000203509]
Predicted Effect probably benign
Transcript: ENSMUST00000078223
SMART Domains Protein: ENSMUSP00000077350
Gene: ENSMUSG00000064262

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203083
AA Change: F314I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145286
Gene: ENSMUSG00000064262
AA Change: F314I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203509
AA Change: F314I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145255
Gene: ENSMUSG00000064262
AA Change: F314I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Meta Mutation Damage Score 0.3131 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The encoded protein is larger than the other gene family members and includes three AIG1 domains (corresponding to the AIG1 protein from Arabidopsis thaliana) whereas other family members have one AIG1 domain. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Adgre1 G A 17: 57,444,087 probably null Het
Agap2 A G 10: 127,091,655 D1135G probably benign Het
Akp3 T C 1: 87,125,224 L45P probably damaging Het
Arfgap3 A T 15: 83,336,704 W71R probably damaging Het
Asic3 G A 5: 24,413,662 probably benign Het
Asph A T 4: 9,630,930 N139K possibly damaging Het
Atr T A 9: 95,865,045 C127S probably benign Het
Auts2 A T 5: 131,451,893 S255T Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cacnb1 A G 11: 98,005,133 L443P probably damaging Het
Cbfa2t3 G A 8: 122,638,144 Q300* probably null Het
Ccer1 A T 10: 97,694,339 D288V unknown Het
Col18a1 G A 10: 77,072,965 P611S probably benign Het
Cpa6 T A 1: 10,337,469 D281V possibly damaging Het
Cyp2e1 A G 7: 140,770,137 Y245C probably damaging Het
Cyp4a31 T C 4: 115,574,766 probably null Het
Entpd1 T C 19: 40,724,986 Y188H probably damaging Het
Epb42 T C 2: 121,033,362 D111G probably benign Het
Espl1 A G 15: 102,324,049 D2064G probably damaging Het
Fat3 A C 9: 15,996,864 V2614G probably damaging Het
Fos A T 12: 85,474,157 M40L probably benign Het
Frmd4b T A 6: 97,306,746 E434V probably damaging Het
Galnt6 A T 15: 100,693,464 D586E probably benign Het
Gapvd1 T C 2: 34,725,063 K474R probably damaging Het
Gm10696 A G 3: 94,176,219 I95T probably benign Het
Gm11639 T A 11: 104,699,140 probably null Het
Gm14393 T G 2: 175,061,783 K110N probably damaging Het
Gm4131 C A 14: 62,480,933 A75S probably damaging Het
Heatr6 G A 11: 83,777,241 V854I probably benign Het
Hic2 T A 16: 17,258,942 M545K possibly damaging Het
Ip6k1 A G 9: 108,045,662 Y331C probably damaging Het
Kalrn C T 16: 34,212,157 probably null Het
Kxd1 T C 8: 70,515,434 K88E probably damaging Het
Lrrc37a A C 11: 103,502,856 V581G probably benign Het
Mex3d A T 10: 80,386,750 V224E Het
Mtx2 T A 2: 74,876,418 C246S probably damaging Het
Mybbp1a A G 11: 72,447,642 probably null Het
Myh6 A G 14: 54,960,307 I458T probably benign Het
Ndufs6 A G 13: 73,320,292 V96A possibly damaging Het
Nemf A T 12: 69,316,741 probably null Het
Notch1 T C 2: 26,459,938 S2397G probably benign Het
Olfr1229 A G 2: 89,282,860 I91T probably damaging Het
Olfr522 T C 7: 140,162,084 I289V probably benign Het
Osbpl1a T C 18: 12,768,592 E619G probably benign Het
Pfkl T C 10: 78,001,455 R95G probably benign Het
Plat T A 8: 22,778,505 I391K possibly damaging Het
Ppp1r21 A G 17: 88,554,886 H244R probably damaging Het
Rapgef3 G C 15: 97,753,877 H578Q probably benign Het
Rnf145 C A 11: 44,524,995 N12K probably damaging Het
Sfxn5 C T 6: 85,332,423 C100Y unknown Het
Sh3rf1 T A 8: 61,372,714 L581Q possibly damaging Het
Sipa1l2 T C 8: 125,468,339 K887E probably benign Het
Stard9 C A 2: 120,701,314 T2684N probably benign Het
Stard9 A C 2: 120,704,542 Q3760P probably benign Het
Stpg2 A G 3: 139,215,295 E87G probably benign Het
Syne2 A G 12: 76,059,457 Q792R possibly damaging Het
Taf7 T C 18: 37,642,548 D322G possibly damaging Het
Tbc1d1 A G 5: 64,173,813 S112G possibly damaging Het
Tbx3 A G 5: 119,672,028 M5V possibly damaging Het
Tmem45b A T 9: 31,428,032 I215N possibly damaging Het
Tpd52 G A 3: 8,963,856 Q43* probably null Het
Trpa1 T A 1: 14,882,233 N858I possibly damaging Het
Ttc30b C T 2: 75,938,061 R116H possibly damaging Het
Ttll5 A G 12: 85,925,764 D767G probably damaging Het
Vmn2r3 G A 3: 64,287,311 T62I probably benign Het
Wdr59 A T 8: 111,458,735 N874K Het
Other mutations in Gimap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Gimap8 APN 6 48658767 missense probably damaging 1.00
IGL02830:Gimap8 APN 6 48656305 missense probably benign 0.01
Kangchenjunga UTSW 6 48659163 missense probably damaging 1.00
lhotse UTSW 6 48658954 missense possibly damaging 0.74
R1224:Gimap8 UTSW 6 48650695 missense probably benign 0.04
R1386:Gimap8 UTSW 6 48656653 missense probably benign 0.04
R1503:Gimap8 UTSW 6 48647529 critical splice donor site probably null
R1560:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R1681:Gimap8 UTSW 6 48656411 missense probably benign 0.01
R2012:Gimap8 UTSW 6 48656353 missense probably damaging 0.98
R2094:Gimap8 UTSW 6 48650568 missense probably benign 0.00
R2937:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R2938:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R3147:Gimap8 UTSW 6 48650506 missense probably damaging 1.00
R4276:Gimap8 UTSW 6 48659083 missense probably benign 0.35
R4281:Gimap8 UTSW 6 48658820 missense probably benign 0.37
R4294:Gimap8 UTSW 6 48658957 missense probably benign 0.00
R4713:Gimap8 UTSW 6 48658986 missense probably benign 0.23
R4750:Gimap8 UTSW 6 48650427 missense probably benign 0.01
R4896:Gimap8 UTSW 6 48659347 missense possibly damaging 0.85
R4936:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R5041:Gimap8 UTSW 6 48659163 missense probably damaging 1.00
R5091:Gimap8 UTSW 6 48656647 missense possibly damaging 0.91
R5215:Gimap8 UTSW 6 48651083 missense possibly damaging 0.88
R5360:Gimap8 UTSW 6 48656302 missense probably damaging 1.00
R6119:Gimap8 UTSW 6 48658954 missense possibly damaging 0.74
R6221:Gimap8 UTSW 6 48658942 missense probably damaging 1.00
R6450:Gimap8 UTSW 6 48656451 missense probably benign 0.03
R7137:Gimap8 UTSW 6 48650253 missense probably damaging 0.99
R7666:Gimap8 UTSW 6 48659155 missense probably damaging 1.00
R7686:Gimap8 UTSW 6 48656072 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGGATGAGGCCTTTTAGAAC -3'
(R):5'- TCACCAGCAGAAAGGCATG -3'

Sequencing Primer
(F):5'- GAGGCCTTTTAGAACTGGTCACAAC -3'
(R):5'- CAGCAGAAAGGCATGGGGAC -3'
Posted On2019-06-26