Mutagenetix > Incidental Mutations

Incidental Mutation 'R7154:Cyp2e1'

557144

Institutional Source

Beutler Lab

Gene Symbol

Cyp2e1

Ensembl Gene

ENSMUSG00000025479

Gene Name

cytochrome P450, family 2, subfamily e, polypeptide 1

Synonyms

Cyp2e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7154 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

140763739-140774987 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140770137 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 245 (Y245C)

Ref Sequence

ENSEMBL: ENSMUSP00000026552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000209253] [ENSMUST00000210235]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026552
AA Change: Y245C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479
AA Change: Y245C

Domain	Start	End	E-Value	Type
transmembrane domain	2	23	N/A	INTRINSIC
Pfam:p450	33	489	1.4e-147	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000209253

Predicted Effect

probably benign
Transcript: ENSMUST00000210235

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered responses to xenobiotics including decreased urethane-induced tumors and allylnitrile- or acetamenophen-associated mortality but increased allylnitrile-induced vestibular function loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030423J24Rik	T	C	13: 70,884,225	F139L	unknown	Het
Adgre1	G	A	17: 57,444,087		probably null	Het
Agap2	A	G	10: 127,091,655	D1135G	probably benign	Het
Akp3	T	C	1: 87,125,224	L45P	probably damaging	Het
Arfgap3	A	T	15: 83,336,704	W71R	probably damaging	Het
Asic3	G	A	5: 24,413,662		probably benign	Het
Asph	A	T	4: 9,630,930	N139K	possibly damaging	Het
Atr	T	A	9: 95,865,045	C127S	probably benign	Het
Auts2	A	T	5: 131,451,893	S255T		Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Cacnb1	A	G	11: 98,005,133	L443P	probably damaging	Het
Cbfa2t3	G	A	8: 122,638,144	Q300*	probably null	Het
Ccer1	A	T	10: 97,694,339	D288V	unknown	Het
Col18a1	G	A	10: 77,072,965	P611S	probably benign	Het
Cpa6	T	A	1: 10,337,469	D281V	possibly damaging	Het
Cyp4a31	T	C	4: 115,574,766		probably null	Het
Entpd1	T	C	19: 40,724,986	Y188H	probably damaging	Het
Epb42	T	C	2: 121,033,362	D111G	probably benign	Het
Espl1	A	G	15: 102,324,049	D2064G	probably damaging	Het
Fat3	A	C	9: 15,996,864	V2614G	probably damaging	Het
Fos	A	T	12: 85,474,157	M40L	probably benign	Het
Frmd4b	T	A	6: 97,306,746	E434V	probably damaging	Het
Galnt6	A	T	15: 100,693,464	D586E	probably benign	Het
Gapvd1	T	C	2: 34,725,063	K474R	probably damaging	Het
Gimap8	T	A	6: 48,656,188	F314I	probably damaging	Het
Gm10696	A	G	3: 94,176,219	I95T	probably benign	Het
Gm11639	T	A	11: 104,699,140		probably null	Het
Gm14393	T	G	2: 175,061,783	K110N	probably damaging	Het
Gm4131	C	A	14: 62,480,933	A75S	probably damaging	Het
Heatr6	G	A	11: 83,777,241	V854I	probably benign	Het
Hic2	T	A	16: 17,258,942	M545K	possibly damaging	Het
Ip6k1	A	G	9: 108,045,662	Y331C	probably damaging	Het
Kalrn	C	T	16: 34,212,157		probably null	Het
Kxd1	T	C	8: 70,515,434	K88E	probably damaging	Het
Lrrc37a	A	C	11: 103,502,856	V581G	probably benign	Het
Mex3d	A	T	10: 80,386,750	V224E		Het
Mtx2	T	A	2: 74,876,418	C246S	probably damaging	Het
Mybbp1a	A	G	11: 72,447,642		probably null	Het
Myh6	A	G	14: 54,960,307	I458T	probably benign	Het
Ndufs6	A	G	13: 73,320,292	V96A	possibly damaging	Het
Nemf	A	T	12: 69,316,741		probably null	Het
Notch1	T	C	2: 26,459,938	S2397G	probably benign	Het
Olfr1229	A	G	2: 89,282,860	I91T	probably damaging	Het
Olfr522	T	C	7: 140,162,084	I289V	probably benign	Het
Osbpl1a	T	C	18: 12,768,592	E619G	probably benign	Het
Pfkl	T	C	10: 78,001,455	R95G	probably benign	Het
Plat	T	A	8: 22,778,505	I391K	possibly damaging	Het
Ppp1r21	A	G	17: 88,554,886	H244R	probably damaging	Het
Rapgef3	G	C	15: 97,753,877	H578Q	probably benign	Het
Rnf145	C	A	11: 44,524,995	N12K	probably damaging	Het
Sfxn5	C	T	6: 85,332,423	C100Y	unknown	Het
Sh3rf1	T	A	8: 61,372,714	L581Q	possibly damaging	Het
Sipa1l2	T	C	8: 125,468,339	K887E	probably benign	Het
Stard9	C	A	2: 120,701,314	T2684N	probably benign	Het
Stard9	A	C	2: 120,704,542	Q3760P	probably benign	Het
Stpg2	A	G	3: 139,215,295	E87G	probably benign	Het
Syne2	A	G	12: 76,059,457	Q792R	possibly damaging	Het
Taf7	T	C	18: 37,642,548	D322G	possibly damaging	Het
Tbc1d1	A	G	5: 64,173,813	S112G	possibly damaging	Het
Tbx3	A	G	5: 119,672,028	M5V	possibly damaging	Het
Tmem45b	A	T	9: 31,428,032	I215N	possibly damaging	Het
Tpd52	G	A	3: 8,963,856	Q43*	probably null	Het
Trpa1	T	A	1: 14,882,233	N858I	possibly damaging	Het
Ttc30b	C	T	2: 75,938,061	R116H	possibly damaging	Het
Ttll5	A	G	12: 85,925,764	D767G	probably damaging	Het
Vmn2r3	G	A	3: 64,287,311	T62I	probably benign	Het
Wdr59	A	T	8: 111,458,735	N874K		Het

Other mutations in Cyp2e1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Cyp2e1	APN	7	140769153	missense	probably benign	0.17
IGL01755:Cyp2e1	APN	7	140774556	critical splice acceptor site	probably null
IGL01884:Cyp2e1	APN	7	140773750	missense	probably benign	0.16
IGL01950:Cyp2e1	APN	7	140764961	critical splice donor site	probably null
IGL01964:Cyp2e1	APN	7	140763866	missense	probably damaging	1.00
IGL02430:Cyp2e1	APN	7	140770226	missense	probably damaging	1.00
IGL02505:Cyp2e1	APN	7	140769156	missense	probably damaging	1.00
IGL02596:Cyp2e1	APN	7	140770118	missense	probably damaging	0.99
IGL02725:Cyp2e1	APN	7	140763915	missense	probably null	1.00
IGL02887:Cyp2e1	APN	7	140763911	missense	probably damaging	1.00
IGL03114:Cyp2e1	APN	7	140773129	missense	possibly damaging	0.95
IGL03146:Cyp2e1	APN	7	140770221	missense	probably benign	0.00
IGL03340:Cyp2e1	APN	7	140764854	missense	probably damaging	1.00
R1396:Cyp2e1	UTSW	7	140773079	missense	probably damaging	0.98
R2111:Cyp2e1	UTSW	7	140773634	missense	probably damaging	1.00
R2230:Cyp2e1	UTSW	7	140764914	missense	probably damaging	1.00
R2231:Cyp2e1	UTSW	7	140764914	missense	probably damaging	1.00
R2383:Cyp2e1	UTSW	7	140770068	missense	probably benign	0.06
R3778:Cyp2e1	UTSW	7	140763909	missense	possibly damaging	0.58
R4082:Cyp2e1	UTSW	7	140771078	missense	possibly damaging	0.67
R4707:Cyp2e1	UTSW	7	140763908	missense	possibly damaging	0.58
R4751:Cyp2e1	UTSW	7	140774716	nonsense	probably null
R4784:Cyp2e1	UTSW	7	140763908	missense	possibly damaging	0.58
R4792:Cyp2e1	UTSW	7	140773675	missense	probably benign
R4917:Cyp2e1	UTSW	7	140774614	missense	possibly damaging	0.94
R4934:Cyp2e1	UTSW	7	140770117	missense	probably damaging	1.00
R5092:Cyp2e1	UTSW	7	140774735	missense	probably damaging	1.00
R5388:Cyp2e1	UTSW	7	140763993	missense	probably damaging	1.00
R5423:Cyp2e1	UTSW	7	140770118	missense	probably benign	0.01
R6740:Cyp2e1	UTSW	7	140763780	unclassified	probably benign
R7065:Cyp2e1	UTSW	7	140763993	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGACTTGGAGAACAGCACTCTC -3'
(R):5'- GATGCAACTGTGGTGCTCAG -3'

Sequencing Primer
(F):5'- TTGGAGAACAGCACTCTCAAAAG -3'
(R):5'- GCGTCAGCACCAGAGATTG -3'

Posted On

2019-06-26