Incidental Mutation 'R7154:Sh3rf1'
ID557146
Institutional Source Beutler Lab
Gene Symbol Sh3rf1
Ensembl Gene ENSMUSG00000031642
Gene NameSH3 domain containing ring finger 1
SynonymsSh3md2, Posh, 2200003J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R7154 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location61223872-61396071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61372714 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 581 (L581Q)
Ref Sequence ENSEMBL: ENSMUSP00000034060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034060] [ENSMUST00000209611]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034060
AA Change: L581Q

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034060
Gene: ENSMUSG00000031642
AA Change: L581Q

DomainStartEndE-ValueType
RING 12 52 5.3e-9 SMART
low complexity region 83 90 N/A INTRINSIC
SH3 137 192 1.67e-18 SMART
SH3 199 258 4.84e-15 SMART
low complexity region 366 376 N/A INTRINSIC
low complexity region 397 405 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
SH3 454 511 7.92e-20 SMART
low complexity region 558 569 N/A INTRINSIC
low complexity region 638 651 N/A INTRINSIC
low complexity region 700 734 N/A INTRINSIC
SH3 835 891 1.47e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209611
AA Change: L581Q

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an N-terminus RING-finger, four SH3 domains, and a region implicated in binding of the Rho GTPase Rac. Via the RING-finger, the encoded protein has been shown to function as an ubiquitin-protein ligase involved in protein sorting at the trans-Golgi network. The encoded protein may also act as a scaffold for the c-Jun N-terminal kinase signaling pathway, facilitating the formation of a functional signaling module. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Adgre1 G A 17: 57,444,087 probably null Het
Agap2 A G 10: 127,091,655 D1135G probably benign Het
Akp3 T C 1: 87,125,224 L45P probably damaging Het
Arfgap3 A T 15: 83,336,704 W71R probably damaging Het
Asic3 G A 5: 24,413,662 probably benign Het
Asph A T 4: 9,630,930 N139K possibly damaging Het
Atr T A 9: 95,865,045 C127S probably benign Het
Auts2 A T 5: 131,451,893 S255T Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Cacnb1 A G 11: 98,005,133 L443P probably damaging Het
Cbfa2t3 G A 8: 122,638,144 Q300* probably null Het
Ccer1 A T 10: 97,694,339 D288V unknown Het
Col18a1 G A 10: 77,072,965 P611S probably benign Het
Cpa6 T A 1: 10,337,469 D281V possibly damaging Het
Cyp2e1 A G 7: 140,770,137 Y245C probably damaging Het
Cyp4a31 T C 4: 115,574,766 probably null Het
Entpd1 T C 19: 40,724,986 Y188H probably damaging Het
Epb42 T C 2: 121,033,362 D111G probably benign Het
Espl1 A G 15: 102,324,049 D2064G probably damaging Het
Fat3 A C 9: 15,996,864 V2614G probably damaging Het
Fos A T 12: 85,474,157 M40L probably benign Het
Frmd4b T A 6: 97,306,746 E434V probably damaging Het
Galnt6 A T 15: 100,693,464 D586E probably benign Het
Gapvd1 T C 2: 34,725,063 K474R probably damaging Het
Gimap8 T A 6: 48,656,188 F314I probably damaging Het
Gm10696 A G 3: 94,176,219 I95T probably benign Het
Gm11639 T A 11: 104,699,140 probably null Het
Gm14393 T G 2: 175,061,783 K110N probably damaging Het
Gm4131 C A 14: 62,480,933 A75S probably damaging Het
Heatr6 G A 11: 83,777,241 V854I probably benign Het
Hic2 T A 16: 17,258,942 M545K possibly damaging Het
Ip6k1 A G 9: 108,045,662 Y331C probably damaging Het
Kalrn C T 16: 34,212,157 probably null Het
Kxd1 T C 8: 70,515,434 K88E probably damaging Het
Lrrc37a A C 11: 103,502,856 V581G probably benign Het
Mex3d A T 10: 80,386,750 V224E Het
Mtx2 T A 2: 74,876,418 C246S probably damaging Het
Mybbp1a A G 11: 72,447,642 probably null Het
Myh6 A G 14: 54,960,307 I458T probably benign Het
Ndufs6 A G 13: 73,320,292 V96A possibly damaging Het
Nemf A T 12: 69,316,741 probably null Het
Notch1 T C 2: 26,459,938 S2397G probably benign Het
Olfr1229 A G 2: 89,282,860 I91T probably damaging Het
Olfr522 T C 7: 140,162,084 I289V probably benign Het
Osbpl1a T C 18: 12,768,592 E619G probably benign Het
Pfkl T C 10: 78,001,455 R95G probably benign Het
Plat T A 8: 22,778,505 I391K possibly damaging Het
Ppp1r21 A G 17: 88,554,886 H244R probably damaging Het
Rapgef3 G C 15: 97,753,877 H578Q probably benign Het
Rnf145 C A 11: 44,524,995 N12K probably damaging Het
Sfxn5 C T 6: 85,332,423 C100Y unknown Het
Sipa1l2 T C 8: 125,468,339 K887E probably benign Het
Stard9 C A 2: 120,701,314 T2684N probably benign Het
Stard9 A C 2: 120,704,542 Q3760P probably benign Het
Stpg2 A G 3: 139,215,295 E87G probably benign Het
Syne2 A G 12: 76,059,457 Q792R possibly damaging Het
Taf7 T C 18: 37,642,548 D322G possibly damaging Het
Tbc1d1 A G 5: 64,173,813 S112G possibly damaging Het
Tbx3 A G 5: 119,672,028 M5V possibly damaging Het
Tmem45b A T 9: 31,428,032 I215N possibly damaging Het
Tpd52 G A 3: 8,963,856 Q43* probably null Het
Trpa1 T A 1: 14,882,233 N858I possibly damaging Het
Ttc30b C T 2: 75,938,061 R116H possibly damaging Het
Ttll5 A G 12: 85,925,764 D767G probably damaging Het
Vmn2r3 G A 3: 64,287,311 T62I probably benign Het
Wdr59 A T 8: 111,458,735 N874K Het
Other mutations in Sh3rf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Sh3rf1 APN 8 61329336 missense probably damaging 1.00
IGL01071:Sh3rf1 APN 8 61225959 missense probably damaging 1.00
IGL01485:Sh3rf1 APN 8 61329331 missense possibly damaging 0.79
IGL01587:Sh3rf1 APN 8 61226058 missense probably damaging 0.99
IGL02412:Sh3rf1 APN 8 61372689 missense probably benign 0.35
IGL02649:Sh3rf1 APN 8 61363191 missense probably damaging 1.00
limpid UTSW 8 61329258 missense probably damaging 1.00
IGL02835:Sh3rf1 UTSW 8 61226047 missense probably damaging 1.00
R0009:Sh3rf1 UTSW 8 61226293 missense probably damaging 0.97
R0016:Sh3rf1 UTSW 8 61374138 missense probably benign 0.18
R0040:Sh3rf1 UTSW 8 61329252 missense possibly damaging 0.96
R0040:Sh3rf1 UTSW 8 61329252 missense possibly damaging 0.96
R0278:Sh3rf1 UTSW 8 61374018 missense probably damaging 1.00
R0395:Sh3rf1 UTSW 8 61393662 splice site probably benign
R0733:Sh3rf1 UTSW 8 61372560 missense probably benign 0.00
R0790:Sh3rf1 UTSW 8 61329258 missense probably damaging 1.00
R1028:Sh3rf1 UTSW 8 61393787 missense possibly damaging 0.94
R1569:Sh3rf1 UTSW 8 61384862 missense probably damaging 1.00
R1654:Sh3rf1 UTSW 8 61361745 missense possibly damaging 0.92
R1799:Sh3rf1 UTSW 8 61372627 missense probably damaging 0.99
R1960:Sh3rf1 UTSW 8 61384863 missense probably damaging 1.00
R2181:Sh3rf1 UTSW 8 61363238 missense probably damaging 0.98
R2184:Sh3rf1 UTSW 8 61372654 missense probably damaging 0.99
R2330:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2331:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2332:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2967:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R2994:Sh3rf1 UTSW 8 61372575 missense probably benign 0.10
R3159:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3195:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3196:Sh3rf1 UTSW 8 61226287 missense probably benign 0.01
R3724:Sh3rf1 UTSW 8 61372722 missense probably benign
R4692:Sh3rf1 UTSW 8 61353854 splice site probably null
R4712:Sh3rf1 UTSW 8 61361759 missense probably benign 0.00
R5214:Sh3rf1 UTSW 8 61372731 missense probably damaging 0.98
R5409:Sh3rf1 UTSW 8 61374245 missense probably benign 0.01
R5590:Sh3rf1 UTSW 8 61361732 missense probably benign 0.11
R5651:Sh3rf1 UTSW 8 61363167 missense probably damaging 1.00
R6976:Sh3rf1 UTSW 8 61361732 nonsense probably null
R7126:Sh3rf1 UTSW 8 61349424 missense probably benign 0.01
X0066:Sh3rf1 UTSW 8 61226197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCCTCCCAAGCTAAAGTCTC -3'
(R):5'- CTGCTGGCCATATGGTTTGC -3'

Sequencing Primer
(F):5'- AGCTAAAGTCTCTATGTCTACTGCGG -3'
(R):5'- CTGGCCATATGGTTTGCTAGTTTG -3'
Posted On2019-06-26