Incidental Mutation 'R0585:Pknox2'
ID55716
Institutional Source Beutler Lab
Gene Symbol Pknox2
Ensembl Gene ENSMUSG00000035934
Gene NamePbx/knotted 1 homeobox 2
SynonymsD230005H23Rik, Prep2
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R0585 (G1)
Quality Score194
Status Validated
Chromosome9
Chromosomal Location36890982-37147407 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 36909760 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039674] [ENSMUST00000080754] [ENSMUST00000175938] [ENSMUST00000177218]
Predicted Effect probably benign
Transcript: ENSMUST00000039674
SMART Domains Protein: ENSMUSP00000035806
Gene: ENSMUSG00000035934

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080754
SMART Domains Protein: ENSMUSP00000079578
Gene: ENSMUSG00000035934

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175938
Predicted Effect probably benign
Transcript: ENSMUST00000176471
SMART Domains Protein: ENSMUSP00000135249
Gene: ENSMUSG00000035934

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 96 181 4.6e-42 PFAM
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177080
SMART Domains Protein: ENSMUSP00000135444
Gene: ENSMUSG00000035934

DomainStartEndE-ValueType
HOX 259 324 4.4e-14 SMART
low complexity region 386 395 N/A INTRINSIC
coiled coil region 399 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177218
SMART Domains Protein: ENSMUSP00000135581
Gene: ENSMUSG00000035934

DomainStartEndE-ValueType
HOX 288 353 8.54e-12 SMART
low complexity region 415 424 N/A INTRINSIC
coiled coil region 428 465 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeodomain proteins are sequence-specific transcription factors that share a highly conserved DNA-binding domain and play fundamental roles in cell proliferation, differentiation, and death. PKNOX2 belongs to the TALE (3-amino acid loop extension) class of homeodomain proteins characterized by a 3-amino acid extension between alpha helices 1 and 2 within the homeodomain (Imoto et al., 2001 [PubMed 11549286]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Tspan3 A T 9: 56,145,932 probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Pknox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Pknox2 APN 9 36923742 missense probably damaging 1.00
IGL02019:Pknox2 APN 9 36923633 missense probably damaging 1.00
IGL02706:Pknox2 APN 9 36936379 missense probably benign 0.18
IGL03018:Pknox2 APN 9 36954697 missense probably damaging 1.00
IGL03374:Pknox2 APN 9 36923670 missense probably damaging 0.98
PIT4494001:Pknox2 UTSW 9 36954691 critical splice donor site probably null
R1786:Pknox2 UTSW 9 36909684 missense probably damaging 1.00
R1843:Pknox2 UTSW 9 36954831 missense possibly damaging 0.77
R1861:Pknox2 UTSW 9 36923661 missense probably damaging 1.00
R2252:Pknox2 UTSW 9 36910520 missense probably benign 0.12
R2696:Pknox2 UTSW 9 36909691 nonsense probably null
R2843:Pknox2 UTSW 9 36894328 missense probably benign 0.00
R4576:Pknox2 UTSW 9 36923548 intron probably benign
R4632:Pknox2 UTSW 9 36894413 missense probably benign 0.00
R4705:Pknox2 UTSW 9 36923638 missense possibly damaging 0.92
R4754:Pknox2 UTSW 9 36909720 missense probably damaging 0.98
R5974:Pknox2 UTSW 9 36936322 missense probably damaging 1.00
R5984:Pknox2 UTSW 9 36923726 missense probably damaging 1.00
R7014:Pknox2 UTSW 9 36909667 missense probably damaging 1.00
R7387:Pknox2 UTSW 9 36957068 intron probably benign
R7488:Pknox2 UTSW 9 36954831 missense probably benign 0.26
R7769:Pknox2 UTSW 9 36895306 splice site probably null
RF016:Pknox2 UTSW 9 36909609 critical splice donor site probably benign
RF061:Pknox2 UTSW 9 36909609 critical splice donor site probably benign
X0063:Pknox2 UTSW 9 36923769 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCAATGGGCTATTTATCACCCCTTG -3'
(R):5'- CAGCTCCAACTACTCTGCACTTCAG -3'

Sequencing Primer
(F):5'- acacacacaaatgcacacc -3'
(R):5'- accatcacagccaacctac -3'
Posted On2013-07-11