Incidental Mutation 'R0585:Tspan3'
ID55717
Institutional Source Beutler Lab
Gene Symbol Tspan3
Ensembl Gene ENSMUSG00000032324
Gene Nametetraspanin 3
SynonymsTM4-A, tetraspanin, Tm4sf8, tetraspanin TM4-A homolog, Tspan-3, 1700055K04Rik
MMRRC Submission 038775-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R0585 (G1)
Quality Score168
Status Validated
Chromosome9
Chromosomal Location56131725-56165477 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 56145932 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034876] [ENSMUST00000215906] [ENSMUST00000216320]
Predicted Effect probably benign
Transcript: ENSMUST00000034876
SMART Domains Protein: ENSMUSP00000034876
Gene: ENSMUSG00000032324

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 237 1.2e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214970
Predicted Effect probably benign
Transcript: ENSMUST00000215906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216317
Predicted Effect probably benign
Transcript: ENSMUST00000216320
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene. Multiple alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased hematopoietic stem cell number and decreased leukemia incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,723 V267A probably benign Het
9530003J23Rik T A 10: 117,238,451 I44F possibly damaging Het
Brdt T G 5: 107,356,882 probably null Het
Ccdc162 C T 10: 41,586,379 C1474Y probably benign Het
Ces2e T C 8: 104,929,821 S228P probably damaging Het
Clca1 G T 3: 145,032,625 H41N probably benign Het
Cyp2c39 A T 19: 39,536,759 I169F probably benign Het
Cyp2c65 A G 19: 39,069,242 K107R probably benign Het
Cyp2c67 T A 19: 39,638,694 N231Y possibly damaging Het
Eps8l3 G C 3: 107,881,197 D33H probably damaging Het
Evi5 T C 5: 107,813,536 probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Gm3993 T A 12: 20,072,148 probably null Het
Gtf2ird1 A C 5: 134,376,942 L28R probably damaging Het
Hsf4 A G 8: 105,271,031 D75G probably damaging Het
Larp4b A G 13: 9,147,493 T249A probably damaging Het
Larp4b A G 13: 9,170,701 D578G probably benign Het
Matn3 A T 12: 8,961,103 probably benign Het
Myo10 T A 15: 25,736,455 Y428N probably damaging Het
Nf1 T A 11: 79,568,701 D661E probably damaging Het
Nktr A G 9: 121,754,280 probably benign Het
Npbwr1 G A 1: 5,916,458 T279I possibly damaging Het
Olfr665 A C 7: 104,881,499 H264P probably damaging Het
Osmr T C 15: 6,837,793 I341V probably benign Het
Pan2 T C 10: 128,310,515 probably null Het
Pknox2 G A 9: 36,909,760 probably benign Het
Pla2g2d A C 4: 138,779,393 D50A probably benign Het
Ptprk C T 10: 28,575,668 L1051F probably damaging Het
Rap1gds1 G A 3: 139,021,872 T59M probably benign Het
Rps5 T C 7: 12,925,405 V41A possibly damaging Het
Ryr1 G T 7: 29,036,076 D4092E probably damaging Het
Spic T C 10: 88,676,043 Y117C probably damaging Het
Thrap3 A T 4: 126,178,574 probably null Het
Tlr9 C T 9: 106,225,076 T522I probably benign Het
Ttn T C 2: 76,873,159 probably benign Het
Zfp773 T A 7: 7,132,575 I341L probably benign Het
Zmat3 G A 3: 32,361,105 P19S probably damaging Het
Other mutations in Tspan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02880:Tspan3 APN 9 56146516 missense possibly damaging 0.78
R0608:Tspan3 UTSW 9 56147385 critical splice donor site probably null
R1067:Tspan3 UTSW 9 56160820 missense probably benign 0.01
R1368:Tspan3 UTSW 9 56147499 missense probably benign 0.08
R4673:Tspan3 UTSW 9 56136696 missense probably damaging 1.00
R6727:Tspan3 UTSW 9 56147440 missense probably damaging 1.00
R7701:Tspan3 UTSW 9 56147519 nonsense probably null
R7995:Tspan3 UTSW 9 56147154 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCAGGCAGTGACTAGAAAGTGAC -3'
(R):5'- GTGAACCTGCATAGCCAGGATGAG -3'

Sequencing Primer
(F):5'- TAGAAAGTGACAATCAGGTCACACTC -3'
(R):5'- tcagttcttcagtcacactaacc -3'
Posted On2013-07-11