Mutagenetix > Incidental Mutations

Incidental Mutation 'R7154:Espl1'

557175

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7154 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102324049 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 2064 (D2064G)

Ref Sequence

ENSEMBL: ENSMUSP00000064465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000064924] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000169637] [ENSMUST00000170627] [ENSMUST00000229050]

Predicted Effect

probably benign
Transcript: ENSMUST00000001335

SMART Domains

Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
SCOP:d1fxkc_	12	58	4e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000062492

SMART Domains

Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: D2064G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: D2064G

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165671

SMART Domains

Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165717

SMART Domains

Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	72	1.4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166658

SMART Domains

Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	22	143	8.6e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169637

SMART Domains

Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	58	3.4e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170627

SMART Domains

Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	7	99	4.6e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: D2064G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000229942

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030423J24Rik	T	C	13: 70,884,225	F139L	unknown	Het
Adgre1	G	A	17: 57,444,087		probably null	Het
Agap2	A	G	10: 127,091,655	D1135G	probably benign	Het
Akp3	T	C	1: 87,125,224	L45P	probably damaging	Het
Arfgap3	A	T	15: 83,336,704	W71R	probably damaging	Het
Asic3	G	A	5: 24,413,662		probably benign	Het
Asph	A	T	4: 9,630,930	N139K	possibly damaging	Het
Atr	T	A	9: 95,865,045	C127S	probably benign	Het
Auts2	A	T	5: 131,451,893	S255T		Het
Bcl6	G	A	16: 23,966,226	R675*	probably null	Het
Cacnb1	A	G	11: 98,005,133	L443P	probably damaging	Het
Cbfa2t3	G	A	8: 122,638,144	Q300*	probably null	Het
Ccer1	A	T	10: 97,694,339	D288V	unknown	Het
Col18a1	G	A	10: 77,072,965	P611S	probably benign	Het
Cpa6	T	A	1: 10,337,469	D281V	possibly damaging	Het
Cyp2e1	A	G	7: 140,770,137	Y245C	probably damaging	Het
Cyp4a31	T	C	4: 115,574,766		probably null	Het
Entpd1	T	C	19: 40,724,986	Y188H	probably damaging	Het
Epb42	T	C	2: 121,033,362	D111G	probably benign	Het
Fat3	A	C	9: 15,996,864	V2614G	probably damaging	Het
Fos	A	T	12: 85,474,157	M40L	probably benign	Het
Frmd4b	T	A	6: 97,306,746	E434V	probably damaging	Het
Galnt6	A	T	15: 100,693,464	D586E	probably benign	Het
Gapvd1	T	C	2: 34,725,063	K474R	probably damaging	Het
Gimap8	T	A	6: 48,656,188	F314I	probably damaging	Het
Gm10696	A	G	3: 94,176,219	I95T	probably benign	Het
Gm11639	T	A	11: 104,699,140		probably null	Het
Gm14393	T	G	2: 175,061,783	K110N	probably damaging	Het
Gm4131	C	A	14: 62,480,933	A75S	probably damaging	Het
Heatr6	G	A	11: 83,777,241	V854I	probably benign	Het
Hic2	T	A	16: 17,258,942	M545K	possibly damaging	Het
Ip6k1	A	G	9: 108,045,662	Y331C	probably damaging	Het
Kalrn	C	T	16: 34,212,157		probably null	Het
Kxd1	T	C	8: 70,515,434	K88E	probably damaging	Het
Lrrc37a	A	C	11: 103,502,856	V581G	probably benign	Het
Mex3d	A	T	10: 80,386,750	V224E		Het
Mtx2	T	A	2: 74,876,418	C246S	probably damaging	Het
Mybbp1a	A	G	11: 72,447,642		probably null	Het
Myh6	A	G	14: 54,960,307	I458T	probably benign	Het
Ndufs6	A	G	13: 73,320,292	V96A	possibly damaging	Het
Nemf	A	T	12: 69,316,741		probably null	Het
Notch1	T	C	2: 26,459,938	S2397G	probably benign	Het
Olfr1229	A	G	2: 89,282,860	I91T	probably damaging	Het
Olfr522	T	C	7: 140,162,084	I289V	probably benign	Het
Osbpl1a	T	C	18: 12,768,592	E619G	probably benign	Het
Pfkl	T	C	10: 78,001,455	R95G	probably benign	Het
Plat	T	A	8: 22,778,505	I391K	possibly damaging	Het
Ppp1r21	A	G	17: 88,554,886	H244R	probably damaging	Het
Rapgef3	G	C	15: 97,753,877	H578Q	probably benign	Het
Rnf145	C	A	11: 44,524,995	N12K	probably damaging	Het
Sfxn5	C	T	6: 85,332,423	C100Y	unknown	Het
Sh3rf1	T	A	8: 61,372,714	L581Q	possibly damaging	Het
Sipa1l2	T	C	8: 125,468,339	K887E	probably benign	Het
Stard9	C	A	2: 120,701,314	T2684N	probably benign	Het
Stard9	A	C	2: 120,704,542	Q3760P	probably benign	Het
Stpg2	A	G	3: 139,215,295	E87G	probably benign	Het
Syne2	A	G	12: 76,059,457	Q792R	possibly damaging	Het
Taf7	T	C	18: 37,642,548	D322G	possibly damaging	Het
Tbc1d1	A	G	5: 64,173,813	S112G	possibly damaging	Het
Tbx3	A	G	5: 119,672,028	M5V	possibly damaging	Het
Tmem45b	A	T	9: 31,428,032	I215N	possibly damaging	Het
Tpd52	G	A	3: 8,963,856	Q43*	probably null	Het
Trpa1	T	A	1: 14,882,233	N858I	possibly damaging	Het
Ttc30b	C	T	2: 75,938,061	R116H	possibly damaging	Het
Ttll5	A	G	12: 85,925,764	D767G	probably damaging	Het
Vmn2r3	G	A	3: 64,287,311	T62I	probably benign	Het
Wdr59	A	T	8: 111,458,735	N874K		Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGATGAGACCTGCCCTC -3'
(R):5'- TCTACCATAGACAAGACAGCTTCAG -3'

Sequencing Primer
(F):5'- TGGCCCCCATGTTCAGTG -3'
(R):5'- CAGCTTCAGGGTGTCTGCAG -3'

Posted On

2019-06-26